%PDF-1.5 % 548 0 obj << /Linearized 1 /L 2694688 /H [ 1429 1469 ] /O 550 /E 201360 /N 216 /T 2683600 >> endobj xref 548 34 0000000017 00000 n 0000001152 00000 n 0000002898 00000 n 0000003156 00000 n 0000026719 00000 n 0000026902 00000 n 0000027662 00000 n 0000027927 00000 n 0000028035 00000 n 0000086207 00000 n 0000086888 00000 n 0000087069 00000 n 0000087338 00000 n 0000087601 00000 n 0000087694 00000 n 0000093035 00000 n 0000093334 00000 n 0000093506 00000 n 0000094126 00000 n 0000094380 00000 n 0000094484 00000 n 0000129942 00000 n 0000130431 00000 n 0000130607 00000 n 0000130871 00000 n 0000131123 00000 n 0000136635 00000 n 0000136808 00000 n 0000137976 00000 n 0000138231 00000 n 0000138339 00000 n 0000199357 00000 n 0000200235 00000 n 0000001429 00000 n trailer << /Size 582 /Prev 2683588 /Info 547 0 R /Root 549 0 R /ID [<6cce1af8361de3b4a699a28c8ec057cf><6cce1af8361de3b4a699a28c8ec057cf>] >> startxref 0 %%EOF 549 0 obj << /Type /Catalog /Pages 535 0 R /PageLayout /OneColumn /PageMode /UseNone /OCProperties << /D << /Order [ ] /AS [ << /Event /View /Category [ /View ] >> << /Event /Print /Category [ /Print ] >> << /Event /Export /Category [ /Export ] >> ] >> >> >> endobj 581 0 obj << /S 4829 /Filter /FlateDecode /Length 1376 >> stream xX{LSg?k{j+,HRZCcXA0u0_njf} :Vߝnmd3Nۜ&R_:~]hq8Iw魯B!xp/B o r"& 3k}0DzA! JVe ˉ"h0ĕi #IF̷fM!FbڣU-aǩy"hc/Y\Cu-(QVo|b+q]4b73@"YPA_xMb񭈝^E]pxiÛxcNDip|S%o>8.\by~qb0`f9Cn^qy|^1o_wtc?+`!䫟'?M.`Eŕ>O{NpͿGg~J$Qq<"injȻ#VOE+A^6f8}[5" kƹ6*qFسhe5> &<(u%/&iß`}Mr&h\sS_Ge{J6׊C;kNr略hq^1u &؋MRs ox[%%A}g7aO.>@mBj ܍0 '!I*xv$0Ӡ=$LFBo24&{W,0rC 0 A3ij4"G@I\\14TN܂|gh& \ t=! endstream endobj 550 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /XObject << /X0 551 0 R >> /Font << /F1 552 0 R /F2 558 0 R /F3 564 0 R /F4 570 0 R /F5 574 0 R >> >> /Contents 580 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 551 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 473 /Height 473 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 23345 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( )5,GrqYwZqmo4NInjY6o]ȭD%@Ѱe=-n I:(0((((((((((((((((((((((((({o&n5i_"#MRd$k.VMVF4=O&Wʑ͒<xM N1 Km+{i Իi p ZiZa+Xg6&7cwzܼ@;²DZ[J7;Pڝ׽eo3 ~o/L)9-=@o7iip Ȼ刐B眃*y|<+빻x *T_dU"Q'1-[h!HRF,W9Mwx%1C=ê[۩k~@a2Hx#5ˋKۨ{x#?LSHeNKHC` Egki?[WmqGzos "X:DFۻ4i4iiii! =4Ѹcf ~5+)mntR QGm*^ok4KߝmOhWzNu=a&}N1:zSoA ] z%g 7,օeVJRv6u/bK<$?5Oq*E"l8 xS(;G(*7T c hL_W>֩hqosEi,]d%Tս^ilnG'UwYvcbdC(̓?s]m'M&X6By`pzk#K&yP[|f'ڵe4Ե֛N:l4 J,|'#~=mRMQ=nVޝ4ܴFuأly dcǩijJ ocZeuFE%%Cц&OqG?7 >nݽQvWeri 8Ms#M4Ӎ4M4M44M8M1 4N4 5x@/km_|&~#J/4i{\ޚoia?]NQ&o+x_UUȓ7x앉!JNҶ SڵEEz[("nxsUB˙]4_+8X_# ;ܝøkדZ±ZE\d+f[C$m-w*ڙ2oOLUʎZX۪5'A\{UԿOZԿOZrEZj-H*J8 hE0 FEF)ڨG/Gm(H¥{hf5 =!~zD1]IRoQdUdr`qɭ+̶71(A$bG$`۔ VBIX.ewcsQi^}Kpd0)?f%{3ZB5Pvyso"3v.!սI~s"UA8ntYdmD`}r) <|Ȋʼn43'i*}'ism.=Qj6XK vcvhպ.é?*״CzjY> q(Inz1Ddi%iƚkqiƚiiqbii4N4@<֭K- mw}'\czu&:59s5sJX'cQ*+xEUȬ7{XH;znjnj62R-DSTDj@j iԔJ 8vi?4i3M&5q5456"Y鋦%\~R{ yWgq#KZrma(4M8Mfh4M8M1 4N4LCM4Ӎ4M4M44SM4C]κ &4>';zvm_|&~#tj&_Gn?U?޽S&$SOm +߃ሓj)%& 96<+ uq:'f#xW@mNxdWz0Im pOk6{Z]fGI`cV[پfahSu&龕3U{WzdݧT«s }XQEQEQEQEQEQEu?1)2MF4ۋS~q:ټcǡh#a nӃN*ξ h] 0=?{XxNR^`&7EI鑎9ϥtѥ_^-z^_k.BvV+GSxQkRIkkgp3+8#֫C aA&rMPVɿda֑>__M)4Ji4Ji4Ji4Ji 1 4N4@5F] [k* Ң+9ogKM[qq4;C3T~Ǎt_]/]s_ / +cLl3jtqՓU/-޸s&R:UkcezRh(((((4PheJђ)3M@a2Pk*zM]EmBrOHaMNQOqJMV^A\,%-}iJ2qwA(+1hEmK<%?[ڟxK1X1iyVA(jpjpjVɃRQr]ԅ=ԛ\yjijiji4+M4 昀ɃHPV5m# q֐"He>ZF^! 4Қi,CHh4iM1iM0M)44SM4C] [k5@/Uj?E%gk:ݦjfs5;#RQW{]s_ /9}o0gEPm7u.4&tqJX55Q8o®J-+nv=6*V*( ( ( ( ( J(=( + J֗b,؎u{H+{uQ*r1-6ӛ-0\e5?󫢛Ks:(62ms寘qq^|T֗=M8=m5?1X +:{ 34\3K~h341٤&i3@&i3Ib4!4YV'*Pۇj`=qT,uKZEY?O2C*&/OO4ߤ \{ .< :֜1EDiI@4A4!SM4!4hiM4 !4LB? [kc] oЍc[6nAhѬ Ͼ+]^ī'U=9C}mڵBHר>54k*wMhu,}Ǔjmoq\v |g{v_c֮xEUyZLg?y$OURNi~['YZF? 齋JdtUIuQ@Q@Q@Q@Q@Ҁ+MұVՂUG2nX^1Χim6IU=@n:S$R qqg FFH{g`U#>1~C%4 W;gx~?uZfеfI6(h?;~^5Ak7kC$ؒ}; XE'}lm[}:Y+쵨NOn$y;~U.⋼Z+SOF-)bk/s)gSq74 /5 k s @t`k4x dm9E~dִ><ؒLtޠm:ي.^3ߺՆ.t3o3Rr#5U-9~iaqmZMw޿T= ?Hwa?I~Ш@TάGx[Zި>_Z.wCu"̃J?яmT9]]C#SЃ\0i>v50TS` F1ه'TZ7*ufV[izRi7z2*r(qkpROcWFwh࣎AzU. Ǽ*&Hv۴3 wAASXDhӪMl[rϚSY ̍rM RevD<#?Ҭ:jn Ǹ٫ۤ1 *=I4srǖ>kM&$Tu,p*Ks! $B@E\ܸM5(jXmzYݬj u(lғ/4{kC*]Z67|ʜ^\Ƕ} "5'nϱaS5^m_kd&voW"nd"^ш΂YNcX.T=TI!P &NL!sM5s2ZKD$-Ȳջ{.0uz[?G|3hiqSMcPh1v B5ñßFQJ*ltrk>W~Urks43|E"^o7t"wQwU7ʺ?TrOYŷV+X8 \/؟x+6E{(((((nҀ*OҹyJ.+-Uǩ2tPlZP})|Å?zԀoSVm9N(Lހ>bNm"-v ׾`74R$x$jZ펏 >O=qr~<)cl :~Nݾ_Ǧ1ңn?ދQN;p8BRHЃ_3T$& eaЃ騡QUFz ZD6_f=[A!\k=]sKvisL.iњnh3MA%Rym*TrG)m-ĹӬۣX2;ٺX~>? )KE"sIh~cp-AḠFjXO9E4OٟW%Z_]0Ī#9N?:Ӻf`[cdwkG.V}&iw4n4wN (I?.j)RN~tVzh}Fנ6Zb}P#r!?vK|W;IKh!i="ocU}']pDQП^ߍhŬSMХnY:ֱ%|^&fG߷_0bvR?̿&Oz?F|gm=YSh+Uibap>i]--9@ƭSkqnD}ˇhjRl?k?GkmdfYwH=|w4PQ:ҳ[iM4iM15s1w>?"F65k@6?Uj?A#w$ 8?/\t?JnOZ*ԉt:{sңյ=es8DAo۞tU5CÅۇp==iӊkY8QϭP\|E x$ 2ץ2nR@r @>xò[&%]J) &㵆U300p}E>zH2o+t&BE-z.ijd;4f4vh74fkw9*vo}L\Zyx #kimeUDan8fǣ*b{Qq8j:IFeF[V{)Xg611]7<4ЛPek2QiuM 8McU7NiA?*nKѝ}nj'4[SOzʞQm=;#.}Gk5eh~geEy;_qR I MܖNLz6ko\ ͉)m/⧑TUu ic,(xYMJW t(m1fK+pr[^4b3M?*A䋓m(qugqM/^)U LZy牤}[{GĨ_t*#4#c}i:jOtR'YZ7 粻4"#2{Ֆ4J,'1Z]S8P*f~Cwkohi:@I5`#9DƘ1?/3^|ƽ/Z3XM|FQ\YOŮؕ-c1I}c=K{}F)0VS+c5cyg7n W9G5Ʈap*֏dixR{lIERQEQEQEQER7JZk 'r+\?PiO[v}dFE7c֋cҲ$o?:YDf>8?ʶR)lIERQEQEQEQES_:(:qD-TVϡڞ6ai7ܕq5^$PN趓Vg ~ӣu R,BY"ʷ]֫1J? 0` )i(s*o+uZgBֺ {X-#C(?5 ?Jmx[%Bs#Vmc~KoDZsZTT8T_h~XG~a^ IRA`޸=+ޓa|ۮmbw0ߘ淍oG<+8Rp2xTqZ-a\] eڱXf-(z|+S^W>׫naEwlW(ǰ+h/ָ$J1i)k]gpoxZˠ.Fo|.=gmr$\vk+lU[ro$I'ⷪO{T%l^k1ax]rx5xkĎ 7so\V]s1Ak{&) (((()ҝH(&yD^!gn^koW^w -y1O epfy,NHANI+t+]!ZXnZ-8#mIrKr-TlԌ5rTL3S &My$ '| }S{%}Ww}{g%"8*t@? tQB= Jw{,0Cᨭ {"tC(EJfm2B?CT#{wC#ߑW"U[^-^,f4Ȏ#wsy_d*o?A/msT9m;N 灟MOK{XQ Ekevٖ.Omd]>/҂Ц~nMuW5jSQ9k~I{;*?vmǍs_] =biqb h(C ( ( ( ( J( 7I5}#]ːkSY#ta`Ar~#O_wr wu~O?Ui!YNAoʓϡu^&\B A0s1PJӓtq/S\@/&24bd(Yzk𖑢FJ~yڤtI{Q/ike Oڻ*@8>ynG@滭?}E22cb;`f=ڿORBU]I."|HVin[}•O|\߲; )(f#&TFy6(+>#2iV?Q?qw)IyAWE<嬴9cH{9P_DžrokáݷC41o64MvgY_ִx-bf$z͏x[%B'k|_D-ق5PaxZȖk4Hǻ'`d<)Z*=( ԯ4Dw2BM/>SU$X?+:)XiONZKCڍ4۫? +nҝSnk෺G$ٮxҗ:GLǑ3V/_jQ֑j뽑ᖭfRL&IHM4`G#CTT|RٟsC%p@䑂ɯ\6+H2=McZ|VkFҿbR5HtAsp4[1A}G<]@΋$N0(vJ|NڮCh-X*ȭ*u/h2F)~.?sr˽Aqo]IGelw$m's7+#:׏µ8Npi|OOt>6N0O~Eoq ETo&5R|r:iCG^Y3Z4 sq "1R̝m3}{VTf4qv^;%ӷc +UT *VEPEPEPEPEPEP\dV]YJq4~(1N*8oφE1+wY[y"ay4(]}D}rGf8'ּmeeǧ]t >YF ^HuIȪ7!1~5^44Y~f=? qzSJkw귚Έ.(f,T 8>e>~NL9Gn1 {K<1@Z:gMJ EY'sHMsr]it<_ls$cEe8iEIYg}jG:|hѤ=Oa%tqI827L}j+_sζ[4;3q[RkA6F-l Ի}MXVz׏Ca3-fa姩Uѥ,EYIi4 *>HUN9\8Ze ЫM T -:я~UiT ,p֪j񜏙}E_-M-DjA]}(5 ;dVʼz%#2Z-Q$a q5Y);#f)4i YM4BkNuBoO)IE]) ?wKeO?]0NNN#dQEIE=]K:|~eLFӭq>ӌ:^Qd\y<סTn@3[B% na:*u#6"Mk/Vdʣ5y>ĺ C GrW3c}SS۟WiaGJ|/qkjM(].ĸQKYQ@Q@Q@Q@Q@Q@2EȧFEcAx>Fb] W5S\b$n20j.Wrgec֥Y+}=+5SG6~W8x*}Gc]ƍ "G*-)]r׆cٍ=3\j EԶ6-#cc={vvnѵ]k宏̬:d t=Xw{.gRvnCHq@?_5ָIV?z1] ߈.+d >}l{A}O^-zSNܑ_ET5(L%z0Ϩ<\m4WC&;^)T4n0ޏ.sݭDnbx'@<}ͣscIeoWGM;2}owo"mown黪-RnJZZZ<434&M4q4i @&M!5\k ()l㧰46&ݐ&o6џzV۠HUGaQZGmj"A=}ϽX ߑN (42uYŸa<sC=ɜO&X6NyRxWJ@3є~j4Fǰ3Pk+{iQQ SY+C_Ĭ&yҠȐ..ujMe&Vr qBym)DqI] E淆Cy'tkV4OѾTTm&V._Egi.Cq~gY #`POڤ[^]y Fxuv:ԴW.~YkmxehQI6M'ozYy#`UȮKfsI8.i3M&j3L&hA,xu5~ 5d$'7+ 5FK~^ӫEbXAUV6HWMCI+Q\.KɎV~T59sPC}] +<{2\!fx}eN:d~+<]IH6:hVQb Xt ((((((((((((C$aMA k0\Ⓧ|~H ͺ i ՙ7NcJt%bbW]>EwYчQ\.ϧ˶A'p85F9\eMlz-Tق0בj0wG ^W* ?:+ q6E#ovV+`H3Џ'f~YS׃KksS_Q,,#d&s? r)pbtz7~}\uTUl;9&"?:ۈGxR H tҴ?Ov]ʽB~?JT(':^K{c4WWRTe ( P;R=ZܙJЭ|} PNؐgjîXddnk?dojm?R}9(nOE"HKD[#d{VA'Vqю88֐+u(u B .I2y8XoDP$ײ+(WNX8Sך[8a EQҬ71KEQEQEQEQEQEQEQEQEQEQEQEQEQEȩ( ˛@XZ#e=A2U& 亯f^5Ѹdb:pEzޞH =}zzVE[ynlܡ`ĎldOsQ+5{(Ii~6[9 "\''`nƏ- M{WBޢ{;Ъ6ߡ9lTo(ꔷ{|54 :mƠyMC]2AkVć#NRU#ΏSgzn/؇mA%ġcV۰4 +%G,)j0M6j.6 wr8=kt8 rzkFM@Jٷ 9šP8( ) Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@!\@Iaҳ,k r7RȌW%]8a~J[`ݫ:O *7ycwkcO >bOO?]NAj5m+9{D[t8mP,Q{ƷB㊻ Qҭ`W;mn!¨1E!Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@0jJ(U 19+%]Jvй&,܏ʽ&Kpݪ!UFN;⥹:$ }SY̬ԩz`=2Ea"W5kTCjxnc]3) b92k_k ngW9ُG4-&i`Vݟ\*2:Z+a2{Eyu.p+j€n+볇LV6veZOcXъbBk^ 8 qZڅV ;VWR+@Dj(@((((((((((((((((((((((1M( :Bb2Oj8gleZڮ `H }( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (? endstream endobj 552 0 obj << /Type /Font /Subtype /Type0 /Encoding /Identity-H /DescendantFonts [ 553 0 R ] /BaseFont /AOOTUP+TimesNewRomanPS-BoldMT-Identity-H /ToUnicode 557 0 R >> endobj 553 0 obj << /Type /Font /Subtype /CIDFontType2 /FontDescriptor 554 0 R /DW 1000 /CIDSystemInfo << /Supplement 0 /Ordering (Identity) /Registry (Softland) >> /CIDToGIDMap /Identity /BaseFont /BGFKDU+TimesNewRomanPS-BoldMT /W [ 0 [ 778 ] 3 [ 250 ] 8 [ 1000 833 ] 11 [ 333 333 ] 14 [ 570 ] 16 [ 333 250 278 500 500 500 500 500 500 500 500 500 500 333 333 570 570 ] 36 [ 722 667 722 722 667 611 778 778 389 500 778 667 944 722 778 611 ] 53 [ 722 556 667 722 722 1000 722 722 667 333 ] 64 [ 333 ] 68 [ 500 556 444 556 444 333 500 556 278 333 556 278 833 556 500 556 556 444 389 333 556 500 722 500 500 444 ] 177 [ 500 ] 505 [ 722 667 ] 913 [ 271 ] 936 [ 523 ] 942 [ 433 ] 954 [ 1063 ] 971 [ 541 ] 992 [ 234 ] 995 [ 415 ] 1010 [ 577 ] ] >> endobj 554 0 obj << /Type /FontDescriptor /FontName /BGFKDU+TimesNewRomanPS-BoldMT /Ascent 677 /CapHeight 662 /Descent -216 /Flags 262176 /FontBBox [ -558 -307 2000 1026 ] /ItalicAngle 0 /StemV 165 /XHeight 457 /CIDSet 555 0 R /FontFile2 556 0 R >> endobj 555 0 obj << /Filter /FlateDecode /Length 26 >> stream xp. 5 endstream endobj 556 0 obj << /Length1 118239 /Filter /FlateDecode /Length 58070 >> stream xw`E?>3oo.~۫)F A PH " `DAQ `DPĂ=r}]@|>[vvfvvw_݀0BHA  +~'q̔Q4B!1fj ӯ2AuH B/W_3gcSG !R!D^@\!"<2xb!"#pa(+]3E}~-~ ~>p< Jcw#JGnLUWK!Rtԓg3\43KGwR8wgx |*>.LLL鉧O?Zow{;ϻ{GoL3j~-kEZBji|^m֪|)> r}}}Wm?7~3O( _HHRC!{ CE5E%GBτv^  +t*\cÓӲdε={b9r\Źs՜|s۫i? SjD|d8y 2uLf.(ws5u;#^ʥ>>7 usKCi r~"ݫy{z:(7һ#g_gf\V]$rm\? ߕ@)g9ikMPN_(WwrCBO]ܛ@Or].Rn\xP1 (g{b9|s(=W}ǹϝ?U{erZl\Ka4+T>ciZhpB{J|hm<~r:rZZ>;-Nir}G9ߚ(㳿g})B?睸I9/uz?_ylG݁б mǚVc=8ZvhGG]GS#?9}#_^u#{tΑW?HG I;9K k5ɵʧʻ8Ča/@FER(Wr/h.pWAKRqA:M{ueoJu`Ou3u .雛(+v;ZxUƋ˘޺PN-L>wDnZneB+)t ݁DOǑ'3BK0#z=~AgУ:z=F1h9Dk z Dox.:t7Gз4MBd4]uhjB t-Dl Es hD&{7h^WabCjv< ~?GuXz(~ Ez?7'Si ~?7o[C܌vĭX Fb6Ny`+^_/=x/~6lGP v`'ޏ`vcNïWO{}؏_ï7-|!Ƈa.~?@q:8 D_f~)'_ïW\_ïEu#cz~;o7-f~ ^N;|+?Ͽȿ/U5u M- 6?̞g.c8888'?Gcq%?o'_S|D6 `B*X`Cp n# ^A|_NSelɟI+WYoԟӟ׷c,B!d YB V&,n [ۄvYCX*)%, w +{Gsa%DX%ր,كC:Q1q/):gzaQxRxJxZxFxVxN$-Va])dd>/rîsjF{3Şb/G+:qx8H,zqx8BlG}r%Gl9GΕ|. ;ŻernqxxR\%׈kć0 '3>gY|8!BBD "B HTb"fBRq.+FAEC҈b{q'\@II: $D"XT>"H6!$N"RLJHgu 2@n$Md>Y@n& -dU|FoŷwCa]=}C#c_xL\<.O_įobMxFU<+&.!I93KY8+gD8;8I$I'ɒb,5Jdis$)UHV&%\[HiW$ '.eHR r\)Oʗ:IRT$K%RgT*pa.]**RT%EnRwZj/eROWET$ER/G+K:it4H, J((Kå+Rt4RjFI1Xi4^Z M-M&KHS4i$͐fJIȝ.,'w{ r/ϐUd5YC֒AyX-*'FI)iP@~dnfnane33w2˘}A@'gMff;yyyyyļ|9||˴1?2?/ %߹R"?+?'ov9&Or'$F b0Ca ep\9WUrQ;Wzrp]ōs nnp !B[5sK=ܽ-qsgn=y;ĽpssGϹ/NiGo9.HHțƜpa>\>) "0S%Fke|Oߛ|?WCa|=?\)o^cdF?oN=szIMzޡ}>]r}Z~~~JHgM19>O/鰎tNЉ:I:NtF3̺]*dϲwCa]=}C#c_-_A̿v_h: b? Q ?F;]k f(3 tq_2 ,32K7dp I!a}h=Wex6j7ʒV=ˍqAGr(Ё>\_HU܃;r3@qӹ&&`2,Ћyf,͸4e>aA?fr\&g:1L!S~; =̛3AI kw dt8w !!N!ЌЇr3%̿3nxLU\$B?x8ɰ/N+j2Z6r{ҼYܼNE%K˺Wtv^]S㲞zۯ<䊡_9᪑1cǍzI2uμn̽y7_p[z%7߱λ-޷r5k>G}SO3<ܦ[n۾cgϿK{x^ͷΡÏ>Fώ}On?r3{v#On?r3f'7On?r3f̽ȅP\z/QP 6)~ILDAW=ETs0B\w[` Hӡ @}P[*vBfBȏ#+1:|Y[pFE/ Du 33:;\p[wChzWݨ`j_D'⍨0 Sp0rHL$'IAMv\T#*g5d{ y&V|t_ S|.2`̀^Fi[<)'- Pnl#p/`=N0SSp'@΢!o"Ud!W~s|; p^h(g +lw0;lc4(.7~?"71[7|c͇Gp|R4\;n|rƌf6qKsw"J nA:4jAW:9r,f%eWO{7vNo.кS@j.@?y+ wr|~ P@@+RϓW=`~h-Zv3b3gS}rCMAaZTq$TJh<(->flQ4>""[^vJNmGPO|_.ijfw} ̗Nz_354<h d;hO6O7EOaאzETh: ݁Á]O~*^B@EO4~-zƢ4tp) ϣvv%ٽ0Xxb^ٸƠߨ.JP >y*OYD_ xu AeܗXx)ȼ UwM0 #YT 4ز:n=xx C!0OfćBMѪʮ]J;tɎdefCߧyFkZmKYkkve]uz.'mPb Lߌm8Q!. T3PS0Qc[q|9-zL`t to1FCPu1-|ux6ݡmۼUE#F kaFg"ܚܓpssŗu1͵m67/Z vY-p- hl^ D3H[뇵[] ]Ur}q"&4Oj8[s|[q՚ Z\Q5ͩ9[Q39ٛUS Ǝ^2D-1\~( EL`MWǔ0ce,pdbTجv._H@CꯈV\58deQ0D8'{V+y80]Cu@Q]>eQ4- K54ڵE"-{e=™7@%^ZZF՚R;K _NK3(gaZmscm [+y⹎ZKJ0E:j$΂P86[B=UA*=XѢ6L:EU_uLK6=}3fäͺG@<5`t@Sͻ Io^xwZz,EL]@Z 9 K KEH[2xIucA87lP4K.ҖF[@ҷ1qʵ+ЂY6ёhi('^hL+I>QEq}y)c3H'1r<0/nH{GԳ3+PPt|͢|VؽtW5a`MS^n~!["Ǩ*.d7Үo~5@%h!vSTxۧ57j xaRiZ29 qa+)++ssİ.}ZYzw/{q]VaٍV&T١g;tw4NŒwMޮ&9{{o+w˶*zK^7)_{䱃=f:e= mzVzYd*OA^QWwްϵf}5jnf_+̜5gedp2yyy齘 }^N^.pa"N<_IMMtʌS+hRSX=bpwXyl`Ϋ~YY {Wu{.jx7  3f,64jr81}JTUzEʴ@]a*l vG =XT3h%L*"LTڧfܟ[mb>Q\0(̭>1ˣv1jdW5R`v`kUA똕iU*X)^OLbbI^2&~[:U''6vwbJ1¾dTUOԊS2ޤ64A{qNF"%:H6eq/coj"^qih9=)?g*4,>S'n'b[b^ >ł(IFJqgTO 䰃}Nz)֌}>2} O;D?RFm/38%*kRD$*N|C6D)vèǨѵFġv4 U Tn1D'd/RW[%UxػY\3w$@uHi.f 3%AijEO+m1sp+f[+P4.BH.%Pw-[G)c6~# DS,E#ןFfkk"?Oo2͏Ja-w+ GU:zNt4|^@`  %gy5Jxiw>agE2#O3G;6gpP 8OVE0YQn©P[qQjlVNua&fMz0f{{Pl_YoW49S,lxcj<ٮ5=xl4{`s/J 2gq14nJGȈ]D FqN/1"8͸ȨFlt /D*<_khFXU__G@L Z|`KMEaJڣ$8I+e&{z^mv(csUO L X} .!ϑg&]CtNƈsYYM`N:Yt<[Z 6T\d0&a=(䙨 q*GnǍ4#{0n< /G -ohL{ITUx?"FJpPDIy 9AKMMU'Me W,k0ˠA!jUBD<L%% _i.jPW?{\[?hqwU6>wŶ#L31EfrO7Xw9*7Iq+7J?$܈D#QH(]8wvD SA$e1ۍC2vHKN(S$06lsp5iKh78L,l@*g[$[= EIrJr)OO !Λ1,:gѡ'9n=3{Q=i/]W1heOA㲌n5@ORКJ3%DEXQQd dQV0gՋ U3XQ{[#e 4"J"0$-ISHh\x 0ߦ*V|b+rf[ۍN8ʩ =Mgi<?B Ypƹ.%v<.›CpHLH3B- GcWw4)P 5fB^@U&՛K ߜ$J+olOߚ>}!rr{VGzepܹwZ&~so'߶Om6bEɏԉ5pAVFe$98‹}>5&Z# X?ћ5DTB d$EzINr g_wứ<@iF]J8*c2F. IsR' S0H /R|OMf2benvd$m^jO{JZ1 Ah{F3=bҧ'焅l`6{ YX|Jy**HoiB&j1ߥّXo7a3$BEP*3u1k .W{0F{Y\!;I\AnXT@dT/y^qurW+K~QY0(v5gE%(0,h@VrRg[g#Y'' l0':eAXlPYN^Edi}>ro{i(Xջ9^%U˯5&n/_]6zɡ W7^X[*DF]:d1ji*gkDD7?tݚ(Yz#ۻȡ:j9ř8*)Ͱ#'qEGTx3,}!%l nfFic4KP뽣 EP~gN7w)=͖T\-*U _/vU_wষcp.˞(pwJw~z8m߰$[Q6dʹF7N6Z;fC#70񽐠eL/){[O%$p ~K]pFt`:fߨ$>/tGx~B!xÀS,Ba)zu0|׊{DJuq1.GpڋSk ;J5&S|AB!jjG59Q^{se5&g2I`Q}3[vbhI4lJs\FcCV' U!l#>!BS@w<"wp|TڒVQ̵'.)^`koe/ c3v*$Oձx A:T vJ4Mq@&&CcS&8$s)>Kb`{MwfWTR *ƫفmR٪ |:|vMjx9o6`T> _IM5 Hj0,6暰ϤYkg2F0<'ըjd 0$hx! h@9 ‡|H khz[²)@&L 'RUbыnM¤t* "ّچսɲ҆VTv6}B2 @ diH08+s&źlYyapQHKC!ylsrUM3HߏDDW.ݫm<5t92p){z8rYAog~o)C`0ݠy$ߨyRPDZ~,J !JuBRj0/+W%iFcͬ0ɘM'9F[}]%R*S\=lUsIno\s՟y &jL <RH/`s-B|8;jyO} -!OrҘCّ2}m |Ba%@-@݋b_dR-f߰*v}U.WMivOܵeKʉ^ysBҩeР ט3?WPŃFx`ɠ]_U[G1ZSrsfùu[llccQYo{K[Qͽz6"N4]^xw6?K-eQl04x(T}On1LHxd 8lM݅ иzXT2:pޚW6ЈaeeߟE/hRϠ9 D`o=0VbՅBBHrr!dfe%nhB^.SfoYvs"n:)Ħ]VSՈ,p֌+i[~߲G8<j=pϬUv>\3fO~h݇G RkJ_@-TZDhquազXeZm}<c4EcܹF\H4縍x*|A,>/l*TяWEa5LPʤI;SqVߡRmHWQDT9ŔBtExf["j8hpBE"!?t:% mBEܡ,T[l4<\Sj{1S")2J2n~={2\Mq>1˻ i̍CZ-N=?wlpXg`ބwGN:$N/\^qǶSlLˍ3rV3u+,:^KD 0H!HIR9=F@-#hGvt"b}'< bFR-V&ج[͹N8Wg Fa@X&l f>M= L̏,<#VB|5Vjhٺy4񒌂ն X!"x#pɨ\K4%^x5aeh)KL)m2I`t"VS݃uq%BbA ƾh?tٌ_-s<@0օ~C7@MgJ կ qNmae Q$Rͼ3''@˓^ivJţKLi QT/pc7ܾe 5_T.Ȅ {x\ t*,껪2A ϖgw1/,]MGf4kqmYܚ'DŽ+2;MEL=~["6lzc /q_~4OAdшS>WE~)zDNsvJgCgwuvZV͓wI`,% c]]6uak.0f_w.APu5@0iC7sS&+ cW 5O?eT#Ubeef6ҥL1Ic!#C$Z[WՒ*MHN꼚:tB]!4nHF0*S` ƔWl e,Ȯ@+u46?U=Y- j_W?@F5Gs|:C~1.QyLD4G@\r#Pu\uQt^; sh>z龽>FZ'$h@*/.Bd  $ +O0g`YhhT\dJ>`+6JaRC$T{Xr+5o5,ە0/ٶ<|{/&i*K^Zy7"0_[WTv$ᮑR0 76ennən|H|څngu@5Xyry/KBZVY׵oUvt=rq2(op$|u F<77/UhROgC,f2"ߌU\HD"~8מ5td @/It4TBHDE701(.JBBv@G1iٙ!q+G(i|?V ǿMXeaj۟)G 4kL8+vפTqul8^50l0@&€vZ-g A/O5x#"*C BB\/cЃ(ֿOKghڠCG\{L;IDř ?ґxaojmKs}/ M,ƂEM(3H}_i@ F3crnH#%uOrh{6ؽسƳO~:kxSՠfc1QH*/5]ܴlemTQB ;Gڷ# 8çmT&_y\~d20|iجQ4+ VՁ-WMnu.\@=;BMlFAą ;D:R$Xw`zS.ϖP%I)FFЦh |wr6ͧbeJW[WnI)Y|R.-j[DԪi1l*`dW!ѐRZ?uU[a ?bU%t(ǘK~mi1Q1HJuvy0߄^Qq~YB6͝f8ui4c/IѣHj,E7ty^IkĕUAcVyٰ6;ƻfg9fyVwwx>v$W ň YvxKT~Q3y*!Įw> i2jl@Ya=P(Ԕ\fv)fþcև9/î$|Q^Փ:}Ps{Gм^C"M&u.DJ<HumPsQI,uʐU S^_Gtn]X4WҸm.`{DnFӌ2DhOxE`괄PvjVNwBL{89]Hr31_/2=RF~x_X 3{w|ٓ˯2KbCb}hp#dRl߹_󆕣+z IdMsN^G'ŏ>e8'Zf9,o7"9ƈik`vIVI3oz5kwQJ N 7xKHɓ y{[Az GNIOZ2#F1lF627|$((H0kxdRQYr@y;:6d[BL~ $mhJbQ`Nj ZOT;S1Pf82Ih+1ޖyk>3F54%h6%6#%(6.}0^b0K.3O|hl'.v0:|9>w[ ',w[r)XS\ n„۞L$/>ە IUMJ[ڭgv!?/Ocr\r{l>TLG%c3|+83FT8+IJjǚξ5Ջ5owwYNNP=K_S+.d/!L@̋&Ѐ5l]rڻ$oj s}cwϟ3vOɏb&.ݟ!pہx@#Fŀ;ηη2I7.`1~t |)6{\.͆IA bFmƽ;/??_?=]>/? Beff]Κw!M&:]d[pE.$/C2!$<T->)]~((+"kQjaOa=wp΀X.a|B`@MS\?t5)Ugoig oefyye-Oו@T$bw. Bv\je'm6jYW<b(zQ}ߣk"M6AȱJ,gPsXDgE8x} pޝ96ƹȆF͚> }7ƫ{}{OOOO0+3maAYAETpATp(DFԀQ1fy%kQ ň&=U0 L>>w{oݪS9u 3>~H䗻HoL|(phn!P$NOHk̓ :0PI`i:`g%_F/݌1H}:*N-d…N׬[al̹BRz/{Oi=XSFq4u̫] BXKzj\vkwgX/-^R^ww܊G:7 mDCKC_l[tzi /ԷwP9XkZ%Ȧ\ZR2mOAk)LܑJA ې[i/l{{(<>An-!\dH8joUX|}-qqwULPvd"]o/ZK懩7|ԡЙ i+X8wӒcGjfTqA' l,np좯6rnnq&H꿈an^ kN+qsF T3kO/&&ҵ#T}V _Xph'ThwxWծܮãX %-Y 9)+䲸:(AK&,n& x$Nfƶ@#<#D@CN o(`5h֐WgCAьV; 3& vJlzƆdz^+ïTJ8D9r2I|phr-Yԉdz%1DL6yl]juR<ЉcHG0 {&^9qgܰ\9k\M3|HSfC.FϚ'|Wohb>9x /Mj pOGWex<^+-׎Wqj*hld>b;mQ y(+ݕX:;<[nH?%f;kGKc+8cDe"35K{z,\yr$X049*2?P&fp&Q8g;p{x;xLU( Y{. I K$OINq rɮVż,,Ҟ.ND8B&`wF-Q:0$Is)VR1c`B:m-E[,2]p9 Nc80#!- khmv݈aXpFop.x >72_ۣ]嵧>OϡݪZ=2;aƎy^k /Tt5b;‘n*!zkyki: __V0'C( D;_/},?`// ?(rǞiڳw_+=lEV[E]ynW^<`FD6sUM ^gȊoDVKacNkna[23nNW=!SAy/?oEb143dA7Roz]ע>\GUf,EvYtxd>;0v9l= &<3X؜&s-x ΚQ o+|[⟀IeLYFMGt~k2s^5ܤLW& h)NPBgt6\pMhiaȜdIGJtVFxz{khn)OX?z֧W`r˜ƱSyS[isNh+㠭AS])G0=dzʴlZ[贞QE_`cNmzѨ5H}xu'R: x*h,3[1ƾ,KLOvSJʤNri9[pg@26B;xd#PXD:[i2k*Qq)ߟٺgode~-v*!IoP6D!\'lݎ9ph^eo߲op~ä_T?dG.eDf1`zϩ]Xӥ nw' F]]#҂HeCs*yDCĬuȗEE>pPJՖGiЦD.OOĢ7@:LL"&̒N++AP]{6k0WlR ZAvŸ:F;Ӥ{qXiJG*ɗ/;嬆~;p3|9uv/lBQF/OXK1" $" m*Fh1$͋h~gjRʉ3+! ,kJY6 Q9? "2ͩ[x| Z}lymHL&[ʨNU'TΦj!>#*1g\kٸ(tsQc􆲹,Sex^2;X>`/Bt#Ak!$ˢiiR`2uh]m]2LZv:~Ghfmuÿbե##(Iv\gxl,g޼a][ru[.=kRhg-5Z 2mK:|^_T^ 6KI Fu3 aS#"IsLY#}쭲UN$rP?'kŭt OdCh dVV>L6WߞՌK,hS*! xOS_q&TYaIwc9U9ZҖu&ErPEHsp+&-y)p"]I'J<$ lWJ).SM RnkG{9DiGZ4ѡU!K|z4) #8 A&^sQ CiDh 3kk0: sM(ij(J%vŻ;%?]gy3|}sƝqբ\v`kwGSW爖Lhps!{E#z*ߜU1U WW蕗*W_n]wݷ}TVԎ1^kE4v:bSH(fh`IuyaH,8 EPd#b`bmfcl$cR$$S4Z}[Tb?\< 9M$6Mzú ]j:<;jK_:weњŎ-vbgD;S̶ KU[lU):"V(R wR )j\EyNlrOr_%7)C)d&73UQEg Q@aGeP\8((,]Xlh:Lf'={ ld3 a&v &2X֪.Cb#&*@~qVG5^-/\i7^kwYp­4&;pa7ńk1cQ^K*@ *C]VwŊlL6Lp$Q&#d%QOL*{ @b#[,U#ePG[\fSF27t-:Q(,ewS*g3V7t]AF n n r`[pl  {@@}MRm`=P!5pǗ3ibԜnTRd`Jee s~}f{">Y9PQf1̵;} ֶf0/3i xK&IRK -9͐pw5]KmŹ@=m_[\ld*QQÂ8=_C,Df.5}=FFa67DcaEg+7)G*k3R2H\bz"_|Ŷ(il(ĘXffw%W*&@2pW萜RLF1*eUA.-3e 39 U!N0/F-07Ţ.~&s:[>ܳ=E:ܲͼD܅2(ʺi23:PDԞԾԁfs`T|PvK+ dƃ >va)OAyLD#+0>86§-tҕw`WHƮNާjCso W9W/z0V P⩖B@_{uTl@ݭ2gQ15mx [x$ QEATJ>S) HZ+ W sE=TYHaՀ72zJmmY[mm퀍<;2Uy++;N(M/ 0<Ķx.s/"b~2B2Дۙ46$Zv]dG{cyH&&Æ숌I-ш%&٣Q9#1)Ǽ3*7 rEttLjF5̈s\p.4'vOFh¦ ['M7[,Tx6rw/+{7xHEUNe+Vl0^g+Fz ?(fӨbo;;~Bs0QSMbnKv(A%md8 32e&EP6 &^%|U FSV b1PF+dB`t$ LC*͟p`#cƼQ;Su=S4~)p]>&E6T * xxZMqtbP-yQ(8hgRUb>l 򔫧Y̥$F͑geQd:82ݼj3t;~c Icmm98iS-kSTП&Pp#Rh. G44Iu]L7W}S} 36kZ2a1Ųۢ2GL(zhD;CDSwFAOGPb1 yj3O3=uxBiAOuwAwŁCW(PDwu#toi;& h;n2[3L6tS 7ɨ:|F3.QuyZ&3ejL&&$%؄'T%>(|[yLy8HyOQcE(\ {ˠع4Jho~[ox7O'<2,sofGTsLj 7-m *odžZ;M(˞|8iĶӴ #;i +v99[8o id{MZ$VV!S'KR3 7Nx'ĉ U2I\^6>%k-֖Ǵެ:>a(jCĕgrg(͓u;P$ !7'Q$ْa;%q ┦C=|'ޓޚۓ$z*VU]_u!~KU*3)SY17x8'NqkK  ް<5}օV~Y"`k3'WnL%b?XQq8/W}̹^?h֓b/ZO᤬7$ QT)t2/PMmR R9p4h9&k@AbPL rQ~)H ^)@ hLJ D59\Y}\Z -H Cf  Rhl@)[r3hDatvHqహ{"[SgCA[BE""ACE Hc՚N4NOuA9e:rƌћ35lCA32'r?|o޸1c9i;s ˂*ظ\e>>NW:ꨆyD>ݐsmhJ9@.ě?EMJW4#*5-hቨ7&mioddldl50&&~ qm|G|>ҝB}ׇAݮl6>؂ A޲͙s\O !uf2ݕ,ye/BrsɌ>Kgyk[Bަ f2F/U^QZn 7xRJ7\6m3 8»Q XBKpHupp=yI)܅R}0M^b\f?d6lrK4CA`+P( L~ i AH!(%!KtKbeeuzi%yr<YoBUAg@:؈g@? -v̦zȠ J@%MR10}KdգRMNtOi昞! s#[λ33N\s7W{S/}gԍ]ܵn]sE}Sξ`Kb(~l!76g0"o9j !C X9fY,xϏ9Yxg ˹Pvqg{#E@Hj]@c-p(29qPTHXdo[⨦WY+x|4_xӲ]{و mŃ\5E-$x ؁}1Fg+\񮲇ʸO4k~ H%^s5ą*~ 3 (PmAuyv1b ĠA'N V@glpHxE` @L<}X1buSjB9 w=1,ŶƘl';+,DlUάvffT;lY>3kF^ 2Vȡck-A2Q8?(+%ϗ *ZZtid򑅫\sj窊d+^mOcbLj_pu3/%W v_'>`} _>lC6傳ݳ=]AM⦺ yDosuf Ƭ4)yIpNW^^dAe!YYEtX,"F ef8A $7w[Ō25A(C9l鲰nNބL`wmo|P6Y"9 @`gV,~#C%9R H>*%B+OY$ 2"&;9)qmK[iFl9H*kKnd?,rgYUuF\SPEQ.U#$ #GH+۠+Ӟ!+$S73 ni+nsܝNW{?63x!Ppmk{Ap\\i[ܽ4"tYrC7_T}heB ̉ U]Ut36nGz h<\'RRⴒmA.ɝťW\2R| UҕR!I!;!AbRvc1{:0Ĵ[mm9tA #jCGCL(!)H>a}e2quB% CJeȷA ]חI Wݾ䲐ԇ3;+c}gPJf5d]y3U}Lʉz錫S1de^i1e^[cؗ>)떦 e!>HYzCѥu4ĺl-q¼A3ge`!ob郙, ̗Ϊ—eOOa;2=b(܊/LJQ5 v&18~/,'ӛI+ n2]{RBheE+jDHV[!3Iӥ9 VFq1F'*-6"J^k5b*d̒ɂ2ɢ1`|7KM҈]6'*Eh]6/U {_,sz3Y6X3MM76žfr_h4mʨ,E >56X.mrhB~q,wcooZ F~#B-aB )fT}r: nAwi& `V(;9o!f$HunOKpy;Mv{i4o87j3~Lz,+&=&n'5oQ{UF].]?1?ڟ@hڸ+ `;wb+F.͌,i7֤^r9Lv`VK,6%̰M#ZDMU:|<Ό_HB;{Z]$7vg+ @ پ9YU|U]o.;P՜k#zw5eMƬY0j$uIN<$0^쒣™,lF 0p\8MFq&(F61boZb01x Tf(W[YPn> %ɱI6r8}{sT3AuWxɀ*1E$aw ld9HU@#5.և׊\&b_+YA_8r([wcGUOk6]\݊>?zy;>_3cH0O`H[&Inۛ㕠I#Te1M1 !PԼP6bĺ٣,g|l ="<71yvFv(Ķǚ3Od5/3aڬ.d f_7F~avXndv=cV370O26! zdm``#GMفA|ќwg;t:\.3li,:LH'3mexIfwIכO#G(RXӽD[dnc:؇]@]B %i0Djtt_t*Bf|i ^dID*%QXPg#t^p'K큡a2MXYzWcgNϗEY{<.sӣSƢ'. '2.ZiCJl+}+ҷ(B~!d#4-Fi!$# ojv}iً~& ]daޘ717v\q s9PB{a@0 #g0$/n7͆g?^bY2ó| S& &nyg7 [c6\ϊPn8r-_dIfW+^ z5xȐr{/` K+Ν{/v蕓[.O=s]q<5b֌ $Jrv+w><,dX 7`&BzŦ5&>M]ϲH޲S7lw{6 {G0=kPnAxG>O]} :N7vzRo$N*qg1YOW̹Hwåb^W `?VY>\>>v!G,e]K>ֈ\4+/%e ([NNj?# Td'ӉfAѳ4ih{n(z5Zo6 |K)5mx66j&)'94DC>'i?]!U\E|.]H)e"ʜ6E7ߏT˞LE%:"/29͗e|YY"}!co8.dx`гvq]JtYRäTȤ1/jP/Sοi{ΩkY_;t..HŪO*攉w=pt׈9}Hka*w/sHS[SS[ǮؖfȮkqme1Yoʯm #=IUqϓp[.uC.w{bi} H# Q7Z׃(mVںiZ;R:C# 3 :+h@[!j?]{n&%[=^m=| [?YZ>z_7H[ibH.C_ NqGm*tsnA0FG/6rH?k΁ \ q*h#HPjM/: L: .ѩ4i]] ~ n)Z;`;G ajx31܃Vv}:\f G)T0_Lw_p$4z VY;$1~t.BFސct>4ޢ#I[f}8  /M*( <@GP<X0V@z'`?B܋C;V1,-&H$,m/?"Usʟ'-DvH;gi6{:DIqCޠr7pҮ%[#T Wrpq 4e\Lh,^'|rfU>Cժ, Rڏ>t~_2y&0q*aE!mA6fkzS߄\d29׋bǨdݭŏߜaFr- Y+QU~J (" i߻HǕ2j9i~i?weЁ"ȵWBҼ$C^2 et\Y(}s~*/:4Iu!cP9R=ϞD~Ѓ 2}ej(U >?Y<_N9w5=ϡ#(&|lٿ ((Jzl8>'"zi/#QCy wDQZ=-g! ]3 lb@ Du07{h69<1h[*.}=d;h$s6j`n@ tؾ5n2XUϹAw~isBA/4݁`?~?:)Qz- # #%JZIO߱9Ǔ܃ܗ^Gf- Wha](`\]7wA:@@*3:(nT `~f  xv``p-נF8l}A26 ׮E2@x~Q#L &}:O1[N:kC0J_ }6>- uQѳJtnpwܩ\_@yIh A?>DV<;#xAڹ@iWL>HTLkrԗ!!ϗaEq ԯyxs٦F=pJuLI:)?`>w{Q4>&w {3wZFxKԩ|gṓ]<¯]97& d%/)`[22 xe@d[WS Ա\GpX'Le5)Jx9kFNj!o3: VD9Ks#cxih PqBC 'tP'ץ||P _wP7oPIF>cCcߐCǧȧg?`K/ u|SӍQ@~Ei9Xk?v{RΕCtt@,rmi5o{qy=dlyz]SFM3O}SJ U@(+H{߀뗀$Tf&MQh$E0v=6 )A (gڎzG _М  d.@A}2v>B9 y!`wvq[!hB;Qok!:d!d\Muܰ=Ϡ}"z r3d@ŵ;i_olaA'~z@ƶkP{5.4QۂºhMw]ҵ'hcϨ|WidgjsdOoG~cҍ~e@1<:߮tP54GgJcdI8 Juu5B%J_wdLk~=R4C5Q}gއG~RQ3ǣTAmVYh ӱǟ4Ys9W 2LMw*]PN8u^z)6`<4%puc8E9N&ݥ_pr+QI{|% "[WCd ƒT2&J1O[C#mT}QU}D)UW~DvAJƯ|]84 ߜ' (S$Eq?눀8 8%h0 Y+1 cH?wNj|4n/@{ r/c\I2JyV_zo`/3[y|C߈?<$@:w#AZE`:T'JMs!<zOQ2dCJHڭp<4Iս{@QbldI߰46=ޯTo'I,T= S.gx*~b,?<lgnAoW(lSW1 $r`_@q˽AQę4vVi+h 5$&褝p'Y%ַl'9Boxr_!E"8lޛ x   Ȁzk%i Outpl;TܦWq?헨: Vuy篦$_} t.?OSӓt4n}vԮ e8 yNfM:kbT{8JAƽ 68gOC.O iT %^T%UѸ\D7JyT3ctho*ig%W`Pp葷Q݊\qrU ZkU$.Q;S#ɧ$ +#~{= б+o8aOmq߶˷qKrdH\\O}'?n9%-Ө.>6ޮ;ȏI7dF>ȆVd~ ZbUF(**>FE^s!^ XUoQaVrōVF *K] 尻ߠy$ Iq xid̷JoxaDM'T!x`]4n9;`sAU_TZO4F X %{i/<EĜ~U:NB(-&\ Jv3[ JoPܷ0 gG4#I1~ AxXDpP.%[B-6񿀭z46{ Sp#ɝS>CoĈۦ H\Wŝ)ݗ?0ނiBBh>so!䄾es<}\{"(.|.aG1y0qR@a c0X'r/X bkns k01a c01a c01a c01a c010jA$,; SpOe?ZD6FA҉Zt͢ 花,[WyAVTR5h9.W(]UM]L UL}n3/g'5'dVTN@EؔMX`wѤ ػbw<,(&߄?޿O<3;yӞgf8q|HaB,Gd/1[ S̺$>NYP>҆yfEjKv3#ժ(g6NyVoҝi]ILu3?#>?ji1!yƔ!&_ G6zq]?NBVȫ%(4Fgw)ZmA"LJK{x~~'>_oeuʝjgV)]TZ?>FgtILEVҍ5r,ayN7Qљ ] f 3YYY.cg30ҥ13 g6a6e6Hf :E99999ssXKKr J*jV -L/YŬ`f^>f%s?mGGǘǙ''iY9yE%eU5u M-mf.>!1 )3_0_2_1_30213?0?2?Qk +;]2jf>l_۟dkk볃 ٍ!l1;g7a7e7cG#--Qhv e d-fsúٱV68v<[`l2۱۳;;;؉$v2;ݙNc3]]==ٽؽ}}ٙl#;mb ;ö~\ǶUݟdn.``aQ1q I)T4t L,l\<|B"bR2r J*jZ:zF&fv){ .coeocog`ww+ػ{{ؕC#cS3s K+k[;*]=}C#cS3s K+k[;{G'gW7wO/oXs'r's rsחpAZ:ܺz`nnCn#nm qùMM͸Hn nKn7e939p.qyn,5 -7"W|v܎Nn"7MvrӸ nnWn7nwnnOn/nonn_n&⚸fp-\+7kq\:.s ܁A!ܡ"n1ww8ww$ww4w w,wwn%w? 0(8$4 ,<"2 *:&6{{{0%!'DdhD'҇%H2 $ZdmYG'dCBd(FMȦd32lNF-ȖdMƐ,1I,bqK<'cVdk ٖ#IILٞ@v$; d"D&)dg2L# ٕFv'{=^doٗ$di"ͤCf9\FvR%dIH7!rYH$!P,&Hr9CǑ Dr9BSitr9E&sy|r\D.&Kerr\E&אkuzrDn&K-,#I"+t{/$ȃt>0y! %|M!ߒ#L~!'M9[|̥3ww3 D~?O.n^>L7|[V~?~.*w]|7 CCEb0pH(hX8xD$d~ *:&6.>!1 )9%5 -=#3w;=}J~A!aQ1q I)iY9yE%eU5u M-m~.>!1 )9%5 -=#3 +;'7 DAIEPMЅG+  a-amaa]a=a}a0Dh6 Ä&¦fasa0J-!%BNpW0VJZFV' BQ( Pa;a{aaGa'a0Q$L; Sita0Shf MBPf sUO+ v*t B-B@ `PaX8L8\8B8R8J8Z8F8V8N8^8A8Q8I8Y8EX"*&.!)%-#+'/\ \(\$\,\"\*\&\.\!\)\%\-\#\+\'\/ ($,,nze­mrN.appppR_x@xPxHxXxDxTxLx\xBxRxJxZxFxVxNx^xAxQxIxYxExUxMx]xCxSxKx[xGX%+'/| |(|$|,|"|*|&|.|!|)|%|-|#|+|'|/ ($,"*&.!)%-#2"+r"yQEQeQUQu1#q8H\K\[\G\W\O\_,n n(n$čš0q8B\)n!n)GcĬhh=1/ljłXK/@N^AQI N')Tq8]!"*&.!)%-#+Yb,VElm<]b%v=|qxPLQ%7rE-ϑ[Vy?y&ϓ!/w]r#ϗ CCEb0pH(hX8xD$dy|||||||||||||||||||||||||||||||TEɷʷɷw;=}J~A!aQ1q I)iY9yE%eU5u M-my()DAIEQMѕGS+ e-emee]e=e}e2DiP6V*Ô&ʦfese2JQJNqW2VJZFVW JQ))RVe;e{eeGe'e2QLV(;+Site2SiTf)MJRQf+sUO)vt(+Jҭ(B@ `PeX9L9\9B9R9J9Z9F9V9N9^9A9Q9I9Y9EY\\\\\\\\\\\\\\\\ܠܨܤܬ,UnQzeʭmrN.errrrR_y@yPyHyXyDyTyLy\yByRyJyZyFyVyNy^yAyQyIyYyEyUyMy]yCySyKy[yGY||||||||||||||||2*r*QyUPEUReUQUUSu5Qu:H]K][]G]W]O]_nnnQԍա0u:B\nnRGcԬjjSU=5URVQUǩՂZTK@N^AQINT')Tu:]TYjڬVEmUSm<]jڥv=|uzP=P=H=X=D=T].VSWPTRVQUSWOPOTOROVOQggggWWWWרתש׫7777K[^uzzzz\SK]ޭޣޫާTWPTRVQUSWPTRVQUSW_P_T_R_V_Q_U_S_WPTRVQW____ߨߪߩ߫????hjF4^4Q4YS4U4]h}Z?6@ khjiCmcm6Lmmm6Fj[h[j-Y4Gs5Okcmmqxke-жӶvvv&hIdm6UMfhhjik{h{j{i{khj3Fm֤5km6GkZZ6OkתZ֩uiZ6_[-iôõ##ccS%کiڙY9ڹyڅE%ڥeڕU5ڵu ڍMRW[ݪݦݮݡ-Vhwkhji+GGǴǵ''ggWW״׵77wUڻ{ڇG'ڧgڗW7ڷwڏO/گoڟ_?::]%]]5]3zOuuFAXӇ#(}>Fnn9]X}+}k}}[}>^/EzY D}>YOէ.n^>LQ7zE[V}?}ަޡw]zޣ CCEb0pH(hX8xD$d}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~TE՗w;=}J~A!aQ1q I)iY9yE%eU5u M-m}Oɰ.C2|FȈ)#g2z&Y+vf̺2gg6l(3$Ӑ8343,3)fnƎjWwg"kmDLQ6F@PT[V jG=ʿTT3J̛V9@kZG*-2DT,GȄ9]Jz&̃i°}깖T囌TQV "jRYJtzݵΈ t@HzO$} ڃ jgt 51+mTH*䫫yy*Ѽ-Ȯ Jkskڥ,9q(drj6Y̷v6*nTEZJ͒-"K:?.*=JƦJ{wpIEjW&NR (dr4*;Tv\F3R*sD[i!!_cp=j!kNt7MvkMi%S[´p#ZZɔV}n_Յ Y rPϿ #YϩLׂݵ=( e;*GoRÁ三昲BVizցtkxiv5A-P4ꀺhZ-A \pa2mp 5kAoՆiaZm&M7o |&M7o| --[k-[o |߶ |6mo |9怛n9b$s7ps7(o>F<'YP@mh A%P +Wn %wݏG|G|G|/">#>#e_~e_~e_~@nM|^)_|)n;"h -\ u@=P[k 86ېoCnB 6ېoCr1Nb)EeШmԁt`/@}wVށ;;qj@P̓@/Ǘ-hq];f *@Aψ3fz9 Iƌ3y0l|,h,ݎFCLEP # @+utP /1>މKA)ev2;<'Xצ׍k3Pύ%d7ƒXKԋԋԋb^,9VQ/VQ/VQ/VQ/3>loƗ=2ASj`Zґ6"tdt$4LkD3H7-izi^Z5iD2 i""tb:9Lk3 }D~:Ni 6f9 R已:h:@D/ҽB/Th`uh`u,N'tr+NK'ϥOY>eS妓n:9zmVYfYaJVzt?JC-d4:9 l3L'7ѪvUtVѪvUtVѪvUtVѪvUtVѪvR)r*FFi#aqtƱ҆ڳ>U"W"W­OZ 53J8;r $p^c&\a%Va%Va%Va%Va'va'va'va'va'vK0r F.%#`\K0r `8 `8 `8 `8 `8 ` ` ` ` ` `x `x `x `x `x F>'#`|O0 F>F6pF™ g%psM8/ #0 #0 #0 #0 #0 3HHHHHHHH0jgP 3{OHHHHHڰjunJSuެ8>m#m#m#mvF_&8nr٬t/LW(Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Ql#Qlص"aa(b\Ui.Wt趑趑趑趑趑趑趑趑趑趑趑ᅮ\Ȃ&j@y4Z-@}2h"/"/"/"/K/K/K/K/|>}|>}2/ 2/ 2/ 2/  /^y݌^)-F^?kkkkkkkkkkkk/^V2VRT8[ O}OOkkOkkmO<|ZP|Z|Z||Z'i̧u2̧u2|Z'|Z'i̧u26ȧu2|Z'h|UO|UGV@ҊZH+j!ZBZ i , i ,5ZBZ i ,_XHk`!BUH iW}Ke_/З THB/З THB/З THB/З THB/З THB/mnSLwbaߋi^LbھѻULbwѻULbwѻULbwѻULbwѻULbwѻRAb_^+'(с!nZL!Etb3ӝEtbzp)SbzJQK\tR˕.pRBI [J'%4_)=H ()JiPBcL ZJWk ZJWk TJS YJf)jPQy9(]pZPE?=f8?]X9X9~,[>s>s>s".r".r"XX 9j2 LA|iw ;H mhL֘ 1AZc8SؒZ,EFY'q;IyNshS8T;MMՁq5Eee կH73n͌[fƭ3suofJԧpS)^} /IVGt6 T2tÃÃÃÃÃÃÃÃÃÃËOӂ}FcyMCFxssss= = + + ŀĀĀ~L1 4Ӏ_ŀ_ŀ_ň*ؗi`_QP>4/L2K/K %h2~?{xXJҀ4`) XJҀ4`) XJҀ4`)2i25 4_~M l3&wnb߹}&ؑfb߹}f6W-@}2(inb&nb}¦RG"T)4Nt;M4t;M@7t;M@7t,YA&vؑnbG&vؑnbG&vpϙiߑ_L6sm;M6c!_عmb綉&v!jb&v!jb&v!jb|O.]w} |l+5]wӝ |.]cd11YL,&F#bbd11YL,&F#Ō=aL0&<&F#Hcb11ҘiL4&F#Hcb1 cb11yL<&F#cb11yLxM<&F#cb11yL<&F#,x(/F#cb11yL4&F#ĻfL1nĻfL117nĈeb.ob21BLP&F(#eb21BLP&F(#Y.<\N]ح {u|*h]ة ua.Ronlw ua.Nd{kHՅӲӿddd|Zv\Nua.օp,۩[鼹uϻuysuܺzu:{uo:::5<׉[^qة ua.vd9k;ua.ՅӲcw..WWW7NWo:::5<۫k8ԅݺWe{u5[ig:~w^]8-;kJ|u[,;_^qة ua.rvn]ث eudkݭ {utZNW'[Cz.Upaajajajajaje"h -F( +S +S +S +S +S +S +S '-p2zzzzzzzI? R Q Q Q Q Q Q Q '-?-?-?-?-?-?-?-?-p"‰h '-p"‰h '-p"‰h '-hp"‰h '-p"‰h '-p"‰h '$-pB I '$-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-c-c-S-,,,,,,,,#cXYXWXXWXXWXXWXXWXXWXXWXXWXXWXXWXb]aa]aa]aa]aa]aeeeeeeee znbam6F{homm6vb蔋/::RK:V>iF-"S3pV} }P,~M,~M,~M,~M,~M,~MLl36`^x5?vɚ7mH!Y؆damH!Y؆dfa|c2c2c2c2c2c2c2c2gc9yhꃖANc2c2c2c2c2c2cccrcrcrcrcrcrcccccccccccccccccccccccccccccccc{Q |L|L|L|L|L|L|,|,|L|L|L|L|L|L|,|,|L|L|L|L|L|L|L|L|,|L|,|L|,|L|,|L|L|L|L|L|L|L|L|L|L|LÌp~9p~9p~9p~9pV9p^9)Zk1sX1@ߝ;f>.rcG+A@ '. wӹDM|G֚QkPϰ,,F,,Q+ӏ7_⥝v&^ڙV;F3K;.g3~iM[ljaͦVSe vE.sp=y<繓?^|8ȇ|8ȇɕk77i3%s*!nnғJō?d%QF1I_򒾄,n.M>a>E>}'8$g,#Mb̄.ν8 8t#^HbXv)Id'Zfl??4d%&-|fJ>3dTA+^Nc%5c%5$y[IHv$^N"Nro'+qY[{;}.}\? Q.}j.}.}NVۉsfuW‰s4>s'Mr&w'})X'KnxI޽$^H63۬z3L8+%pny `$H+GZFaX`},2H&lP&6Beeb#P&6Beb#P&6BF(l r 11111_ 14i>>.íííííЀ4Pt4o_@t9P@"h4/B 9/FL=#F\Mt62Ұ\QeVߗ2! Cj!}!zJ|1ts9!4,sqxO^襂(޵d16Yrב{r%LsM ŻYc,(Z!>Dq٦6%'2YzqR?G״M5mi.!__iƐw&^S"3d0$iM[A뎥.Srvpak >*3^k5 'EYl^UtZuEmA<& k`4H?9"|ezsm4XSOMeK/BOY֧w#|x>֐{ۇ}ZCɖjѵzsg*bdSn?+{%c7&~>dD\"qt?^Ћ0ϲh  yvU~-yv⪉L$Ͼo!ώZ5QdcMw_.bOa!v;%UB!d G?Sk$צh֠qKKJ9MX*)LC\,./!i4^-7i^BK1}I YIυ%ax&w>%{kMޗЫFZ^èuuzq7>~8oxp~;}nùWVr|0'_ _r)Ga4^^ ӽJո5ͤOSBngkj0oa|*q_z^E1>^04;s-lK:snJm$%C#QD6ɲ7-Σ"ϣ"ϣBj!W ;ׯ=wV\:ֲr.s38f2_rc}\雄!A$rC=~pR/w =p1k0̀],nяe魑@кϰ_kx;^mXae *#3F? 3<#3\6<JxC3 ͼ=4suC354̄5Q#&mX ƯӐ!^CɆc K27d6t<Ͱ{;3lhgeb(+8ݓwC%$ƽ7dމJNJ;);!B'+C>-r#?k{GC;2?d9wa;{CJ~%?ζ)Ff`fsT ]ꋉ3{@[)m vW` \vQ.mn 4ݑ)&D>DkD;zՐI^|=ԘT_Dcf^yŁ~ߟvEOoҟ"],sgԟGgĠ{̡C\Txܿo\ {"E,p' ,w0I< ws&47nQRxO4Q5_n ztOrdFFLÞfi(d )=}pƴprU @i]^6[IvV6CkjZ}I/"6^egd2w*řd?;exm—@n2Ⱦn7(2IɾRNz-;m,}(ْZ(x?.j:{K)c oUSeU(:gYAke'옊g0Mhxvt=ؾӆ TPA]}:Ml >/g:_O',|<owr]*7Ȳ\/ɒLd"*oT2:^Y'M>=De vl=]o wCJ_!d*m$] [Y4&@H)ut=As]!>p>8pH@bcL6~O|]h`Hj]fc"G:%XhS>!#tdA4F }. lEpi ѡH[;GsB(u@ ȶM$ԶYe@$_AIإ T}F}% ]w+Q*QDERA#NtkxM%3TxbTS'L!N䃹t NTnBH͐֨3Vz{guNMc^54 =\k(3$rYjpCdXRcܖdmi:iמ8VGiԽ`k:lTǾ}HFj;R}ktJ5yG:K kڄbθP:E<*JX,k/Rmz%=熎c%$4w^zP ]FE4-~VE":U`VokFň:kNkjZG#SSy*}B :BhX9 ``DvC ^["$\"k%ߣj5 endstream endobj 557 0 obj << /Length 598 /Filter /FlateDecode >> stream x]n@|t #q؇KX9kOHIT˱klk֧8fkx~u^[- 5m=>(/UXN71^Xmz?-M-{:6>yx8˳&kyU1s Tko}UǡbOM>L"vW^{5/g@n8Bl~sZ@%dJ]A%eMKO.>MPʴ2JOK4Wcn_i7.~mw] endstream endobj 558 0 obj << /Type /Font /Subtype /Type0 /Encoding /Identity-H /DescendantFonts [ 559 0 R ] /BaseFont /ACHRDW+BookmanOldStyle-Bold-Identity-H /ToUnicode 563 0 R >> endobj 559 0 obj << /Type /Font /Subtype /CIDFontType2 /FontDescriptor 560 0 R /DW 1000 /CIDSystemInfo << /Supplement 0 /Ordering (Identity) /Registry (Softland) >> /CIDToGIDMap /Identity /BaseFont /AUQYIQ+BookmanOldStyle-Bold /W [ 0 [ 750 ] 3 [ 340 ] ] >> endobj 560 0 obj << /Type /FontDescriptor /FontName /AUQYIQ+BookmanOldStyle-Bold /Ascent 717 /CapHeight 717 /Descent -223 /Flags 262176 /FontBBox [ -191 -362 1463 1065 ] /ItalicAngle 0 /StemV 135 /XHeight 473 /CIDSet 561 0 R /FontFile2 562 0 R >> endobj 561 0 obj << /Filter /FlateDecode /Length 11 >> stream x`  endstream endobj 562 0 obj << /Length1 10824 /Filter /FlateDecode /Length 5241 >> stream xZ}xTџ9M&X`7,J| 1l !dG%" TARjf`#(RO+Z}}M#s3̜9s~g]1EjRhPCWpimcϣښ;gU]6Qb"-cae"0%ػݹded[hExvD]O9@U"5TUӄ@tb#uxN($lڑiȧD>~_j5^[BN"3Zaj2.k/oc")x0~yR\wq.{MhRF_(m7cFsiyw m$AĔJ4~CAYTS_: aKmXLM<+Q'ZU[nރ8<4ri7'ral8dgn!T@2=N'ĝ''D4bޠoy3GƗ%<h=Ȏ" t؅(8^˸^ԈVšܠgShA%P?`L@|R9h'}t^wo w8y,<țDx@VP2Cc"cNU$_A+>ڀӯ=J[1zi}oD8"FV!*R#|Iܧ=IeZ>9 U7bLV¥Ԋ^<{:Jg8Ymlo/ob%oZ%Qj"肸;:u@Q̣iK\VR3 wm(j&q)xܪ,+%ړ65IyӜ'.ױ|-R2oM5uİCxsʀ7xCRb?OO^Ξ=;uk)*2fh"x=n=BW8MP04Q{rJ)DrLn39#_E=Mh.՗? XI2]S''LfhYٿ%e=zgݭ2**$_@@ O>I3WO, 4́>]THѰYִO [H~uے;xtvzNPu7Zb]QiRe]3nGXWqUU3=nn"qީgnU3@Շлd*N J©@*)8\h$왥]/ 5ijuzEEEH"#(iaʳr!'O_J9}Jxtn>r:bbr[9]F"zw8mx]V~6m/%m;66ʴͳ>Ԗ/ն-:Ю vZBC"OEAkՓDK5 a<>GkT*S^/vG`?Z}K@ӂ}4TʒF#L̦b̟>DPMCDmO@;۔d J !Z72w{3;e;|$ sNQY&vq8~p!n?gan'yʻޚw'%2Ow7Tclk9iֻq:bsaBxY^1K_6k5,[;^a۱Iz#K,R%)䍸J}e|Rh: 2O#wIm|c47.e2k!i ޏN>-/hM~̻ڃ;9oᆪbD{_}+|%<Ӗ`=»=>}{{Y+ՠGAwc`}PYkw.Ha#DP'vqzgS~{PK9ƻa=Z J%6XK]fΫJ)]} Mdi#F]ޠ[PÇ%F^ov]ou3ۋ5,HmmeIVF(E ~kןs-YT9kN+-b{f7;wP>»~9땧_s==:0Dv|%yfUqlm=QI tw,v,^X\T}om3;0K\`%+D\-3 ƚoot[%wu&.`/H1jUHIC 4H.*@XN"!̊la E F;o tvp#5*/R!I56I137@šhCp/m,*Qpӟ\pt[xVZ(R/ˆpnò +x! )]0pdFu\({u0vࢯxG3"矇pv%s?0^oTwʗ:^JЮ;] Cƀz_scgyx. yϠ]tkл%g@DւZnF@m XVW-VHH_ bD#./NLr^c\~{_3w母{_ū\4\@KN01`,_,_)ńh*[ʿIt|v\y_9xvhu4C ;j_s(`mk1ͅr9ͱ|IscYm@=Ӽ1̓! 3޹8# AR1?{ff[.[޳66,6̷6T[n6L6Lm}ll=m6-fE:"m6ŦڄS[Y\E3ɞGNk, 8+^OM.h>"@M/mbO pm%6;%76lȑO|-wnvg\յ*l0 A*cK_C`&gub7UWg:$9gr|fTVZ.4ʤ jZi(̄jLaf]5ZiZܴIL]2Mmw`2j;CZ ᦧrԖrS9WA}o{&;a흎I%b [>+^To&sr9JoV{9?mc^;(dI?z3'd6(˗=#țET$™reI|[B*K*~J> stream x]P͊ slOre!a:ff9wbC Ps[S,8 HqN ;+ԩ]QdֹSHmA8^0Pn7{H#zTbYo8 ]ݫq![QFCSHES,WY4w~m{Tq E 𱤜vo endstream endobj 564 0 obj << /Type /Font /Subtype /Type0 /Encoding /Identity-H /DescendantFonts [ 565 0 R ] /BaseFont /ARUWNF+Tahoma-Bold-Identity-H /ToUnicode 569 0 R >> endobj 565 0 obj << /Type /Font /Subtype /CIDFontType2 /FontDescriptor 566 0 R /DW 1000 /CIDSystemInfo << /Supplement 0 /Ordering (Identity) /Registry (Softland) >> /CIDToGIDMap /Identity /BaseFont /BGCHAL+Tahoma-Bold /W [ 0 [ 1000 ] 3 [ 293 ] 36 [ 685 686 667 ] 40 [ 615 ] 42 [ 745 ] 44 [ 483 ] 47 [ 572 893 771 770 657 ] 53 [ 726 633 612 739 ] 61 [ 623 ] 72 [ 594 382 ] 75 [ 640 ] 82 [ 617 ] 87 [ 416 ] 909 [ 306 ] 913 [ 341 387 544 665 ] 928 [ 751 ] 942 [ 509 ] 944 [ 509 ] 951 [ 1097 ] 964 [ 862 ] 972 [ 590 ] 979 [ 542 ] 982 [ 1057 ] 991 [ 341 ] 1000 [ 387 ] 1002 [ 665 ] 1010 [ 1145 341 387 ] ] >> endobj 566 0 obj << /Type /FontDescriptor /FontName /BGCHAL+Tahoma-Bold /Ascent 765 /CapHeight 727 /Descent -207 /Flags 262176 /FontBBox [ -698 -216 1625 1065 ] /ItalicAngle 0 /StemV 165 /XHeight 548 /CIDSet 567 0 R /FontFile2 568 0 R >> endobj 567 0 obj << /Filter /FlateDecode /Length 22 >> stream x```["6P4 endstream endobj 568 0 obj << /Length1 81598 /Filter /FlateDecode /Length 35357 >> stream xx|̝lz#M6 zob(ޛB؂""ŎĂ *AQI;3B<xԙ_ga}%P?lfo'Ō ƏL/L2u7@%G58S3uB*"F.ʔ(wܽ S5bk yN=B8F8hsrR0K|.?FS*Оt(-p0TX* +"/aMl!x^dž ?Q;bA#>-o[-vmm6϶vvveGcI4{ {}}}}r9Z%^^>R\EYĺl/ajo[p_>m?s緜|o8?Z]]gg\Ͼ:۱:[̳9?Ysfәg&4Skܷ*83M+06Nz\xAlmgj^!8 ԱPIz x.,85 >O)ڠeZ#Y܋J:9ÏrLd1$޾)lo*Mv6-js꨺B ,%\KXP rx `2d} .o<AK+m&x>%#!(`$§1|<a4 8ǡ.p?10=06D%04 a3a6̂90Z"\7H;Ҟp'PդH:P."&]HWҍt'=HOQ"*I'w|2 $`R@ sEp2d/2ob%>wď1d, G!2  @9 !dLH#N"2k=@lN"IFd&Ef9d.qhCb<2, "r/!IG9']IURT#$ 29)}WdȒ,ˊlU,[d/[>u:r(r*ɍp9Bvי,&KH)YJ8yyD.5퐗2yB CC#*yƴӴ:_].T%jT]f>g`hd~Ƽy9Vm/OO Fy76|||V>U>S(GQ+'ϕʗW)rFN·YRN^A9T(畟 EgR_p pZUG\UTRV)UJRiM^[M57042gzCG\7?ShO6p]&iEzN*=/m^^^^^ʥҫhwH;*.J{7[;>]it@:(ޓޗ>>>>>KJIG1tB\:)}!})}%}-NKgowM>5}f:b:j:ޯϥsҏMeOyWٯP*/_6)$'0kA>#GH2I!GI*9Fsr|A$_+Շԇi"ߐ %ߑD 5f\לK䒸d.K\nitT:).JW]ep%SE_JoN_J_rҟ|e2P V !PNw7&ݫ S+#"}C)#QhXU)( DDLV(Site\Rf+s>.ԎjgUvW{Џǹ__E}~)?_??? K+v~'.?]_ |%+; wWjO[]>>>WqU\5Wù87<9)wz~Gh5v p"I|y1f% M|c!2DIZ9Bk)DŽvBE&1bq@aF-b>VG(Ta0W' 2a, O VE\!'~g _COүG'§N'tKkpV` ? p? JWpUKRwyÛx7jD" P7խjCݭUԏOcIkZ^TQWT3flDZB't JQ>F\:Χ BKZJe~Z30$ y$OOŧ FqY|V">'n////v0yw ~&?KNVSitu:SVs Egu4lW,9N*x vAwaG8DZu VyD/Lzg^zV_L^3co`C%ga:CG͟?5f>b>j>f>n>aigio`h|KWͧX:Y:[XZO(;{ uZQ0u:{;}}rǸ[,=wΣҭ fx;G p7) J},Oa)w|;K-A] &BߘoM!UHQ3Z~DȥGQ>oF|ߜOd>OP7 gPǽ%-.MϢA/1~5Aa%jgQ'@8jw8C3K|:AWs Q_ǘ߻Of\'cx< 1rh- Xr }7w0crϏ_+ ԏict-FUD(58n0~a$9I4 ixtA"7)+/Ř< ?[Is3p߽ܶwùO&clʥ6 ' >\yr?ם".2V,|76t™ ƈ㞠jX `P>7ŵJ&f~8*ߍ.x G!Tw30$@!aeR q[:'?Bzp'u?ί; >xw=_|X¨q<7h7Vң5h_KK^F^q ٯS-23RS'4oפqlL#*nocU"K@y@3R=D`܇x_X,*kԨ}x_׎u:T_9/d4j_4~LyH^Qa!h;\N4]59FvISXd;Кh C9- }˹ c˝ 1h=a}+6)%1aܾپ00\(697 Ǹ3)v]0޾^`h_\WG;lu|VF +Eھ'#8\_>xݖ-o_4] .kcTs2PT8=s06ceGjc]Aھf؝j/r/VV=O#o`6Ad]FQKVRn@}څ^Sh`F{O3vPna/>.#lD&evP./nQNx^^χqƳ)5=<(Mp8ʭBvZz}]{̷/=ǘ)uǰ2C:k_ÙĢJ/G/> [OdȰ2=;q.# .4krMh6 ԹnڱdYN70/*G¶GcYv;;L{^d( 'Bj<ٓG`nNϳjy[\ Dv+A[( 0/ÐHH~m!;YE } Huf|p($q#?@/fi(&Y~ULl2xb̈́@LiI&bRL!Xḍj8f9Ӽ,x '51rsr *H||Rk;}@ADHj`"%o׮^K$I#\k+gggѐ ΄#f>R #HD& i<{7,׻7- nOw4՚m8Rȭn* (ٜn_IZlX'5%#3#[M>|Ek]z_X8fdQhba!YYQ3?R"5|0qkf,hHD|ʻQ.5'4$.6$  IMuv6;b΍8>݋_Cvr*x ^Ga"ȉD1]&Z>w\acҸ=}>di*ޙM$z':&+s 25@$'k?|/*q5[%cBňQV7.UbSwֵ5l$c߼8/*ldR֪>[lO3]rj f*tlz&{yNݳ]Uq&A'C-VWhțT"@?/p5#c)mI(PmWR5WR &1IqQ gNN$PWuusix\rY3 ^Ё-OD)|Uj/[AsGޓ{2o3Kɔ]34&\꤅JJIVL*NFzy{9zyl_1R_lѬRP6.v뗿UySi&6 c, ڗFPߓ)p2 $ӡj!?5MTKtiF 3$6R|OSl)/`{D>AwV~s~sm V3y?Us7:F8Z}kpMX\Sy,"$'N_򁑪S%Vծ&ar_8Zdp&[g Y79"'`O҈t⺉9D5OozhGDol_U7q۠PWp415ͲA>A-' 1TL`9<;JM$$ʻ3گdb/VJiLhGNydoY,VAYld/<4}8ɭ5|1 ,bqNT\J]+kȺE#SjGmɩOz\PV@o5֨Ӻ%L6`gf86)/$$֖Ԧ)Ş֮;غwHhdدi{F%?5) 3cWLv؅N "AM(FDDr%9 L^ɺeoNiʃ kfPb< "4HeΊ,-$=@RKOz:09Q/j&F15C(KT=v]\τM&Çi'>Ŏý|썲zw[ZI:̲bS8a ZȪ(SYp>Wsƌ@vuu)~}2e1Ř#Ix跔fRR=.Hrf(f)1a-2}Et!"ACXF~cuW+If':r4N|K9*S+LXK>㞂J|+ /N˜)IS*s,bcLՖ=;&{<~鼃Iy?xwM?s=ThfGh)DtX,monv-}LBTkn&#e>NPBBlIhHʗf ^C(qDU5 2OFk%4.Gh 'jzr|砘gÊFM#H !~뢫f~16[XX_3׷>>ىSgaR1T?1a3W#Xdo]IR(%mN}WCeU%xY B'$jBVht]  `we;; t]umZS' fѯ8J+O?U6R&!ڛJEnG$&cj3f5s5VijF@76޾S\Ȑόxqn=6>'O58Md0O u*4‰6 &Ɛ0DWtosNuuI>3Jr=n둒֨_jӻCmv.kKrI&\~*ZҤidx\eG/m?"E a PȲ$!8?`)ۡjxnxpN4YB%o&q/ yܫ*BDBTl:[Hfɤ"v@i)ޮW8o ^XgBڸ޹2 6{) 6goJ_7boQ&$C y`| YPP?QE7<[|^L͈-W8⧉DĂU)iGR<+3eS-+ڽ) mhZ/T'pG3*b5k"*rd ȫ;@JҺUrcg hb#PxH6T1vCdGm3`2 0cv=I)s挻ϵٰ|%j\]1d@?_7ߋ7U_N6b孪+P*.;&9sJTZLCɡ3Y>̗mçspt-o+iR}}+^^^yփ$2pDr>3q5֕'Hͮ>9ҘRvǽ ]W|i1D8}/sVWY=sd/`5`UIb{k$)Yzjf%NU DUz3ENMʱZWl1Z[!jEB*PݢxkUL#*&V1GyB9ثcY|uʦ BCydv|.'!>\omSPBh="KH W^!/~6 >hf>CdOP6;@@yaV>%D*($x轮S$^:ǟ$9#61dg_$^RےO>Z;+r"! }kAVY"4dGs\Z}2 ) )*˻}*"M5':0m`*CmW6tg.˧$ PEYo͝sX"1-M>{fN ^ZZz<nvޠ3[u5cFZK߇`sYn/;`C#8$&Ybk&;BgΠ(2@$<J`ܯ |؅@E`@1^a UDb`+&hcBo\v< h*5blU /_5/nº H~ӍV;bClɮ|hد[$o3Rru}twN>nxڐkϙ:tg[L4fsb7iEwP H<M ?&)f06N]MQQA9{!\D?,^l,[+BC!?:$",n`=1di$f;:F[0ɇTJIvv@ЩrSnIʡGG?6uy}cMX cI6m1H׌~=z%6@Y\.T,^m0zCwQZZC3%<7L2.|N8W05 aMBp9çd(svcL …\%>5ozvv2; S1Ԝc ̄ 83ʨsO2^? ע܂x>d||ddI4?#c<{,vLnץ۾8ص bE7,~O]=h1*Fѕ,-)&_LuYMCmdRC{4wt46!Iݣ6,J ^Ae95<4dIӹϟFy ]+0A|.ްZd Ѻ}S!þgd2Qk= ^m*FB[*ԍKbɅOi5,¦E'p{6^c!:@eA^˼Z~nyuaD1h4vt\TaESE'˃)?&m=Yi2E ?*+O&'^э5쌶љ1p#{TOmZ zwfwOtdnm+vM~ٺl5y. 3yn }%vzIЮq⸮dj ^ݣ]NgUt)6$X~Ήp38,K#vۨgU.U]ڜ2Tt}})iI֊Q?WXOb>͢,fRq -Xi|jaD;w*__ߊ/wi92pNfh]XHj#e8i&[u_fh8[ߺr/*3$w23ɻ{,ڸYVz(ߡemOi6>8]L{j~sfF{??q=R[g7=35eY^ƚ5V{)FcaN+/? :\h]z+Ծp :QGѢ ރ|fM9@}3=O6r)UPWX L\c_w8Yc'Y\a-F} 0OB1':.. f`'/Bw?&p a%]11hDb&b8b"ю  tLcׄyNDoXG/!UuBq3*g끼ҩ McvEkh[4|s;z|Df<ŭ>3fyO}"~̄(#f!#BLGON]W徊l2tJ&'f=mv9hR&fFk0 msHFGj i+]/bHeؖ.r_Olq6djv]XfӧbRݷra  N&0_@h*a3뉇 3^` ?:a _Ǿc)^Z,E@&+zP O@ar/@yziKDBiPL?HwB.W@i&cQ`'ؤHϢd:FOc`1iRolu4;yH09s}d7N5cQWv< fTP3@:v:{wmmȝV]t{ Tjй2T/y 8"`O@`4JBLSџp+J߷ayMẬ.0unhbsXC8}0/uyBq (e#c&{"$^~"VcXe~P!˽X 7}FƋqM1[͛:s7zs1vF`T\O%!Ab"!%|w@/߽q!~v~ Pa6]ޣXX|㯦%\=kϞ%'y1-<sa`cS0>ջއYؾL7~;Oyeh}[eۖ{h}?w1(/.]0G)ALEHgЖgvx?7yY'߬[?&+_;c:9P5{QvwQl=7P&X|/.@x{:;C(Fyc}&3Yr?g!buaT^m'|q 4$<m3h?Aӯcz"5x6GW>Dw9/@~װk?3B"lX>u 41]iH]k԰}`;f'o7>,B(LB}X qhB kE="qq*X"m>ķ!N.m<='uf~ #)k+s~ ){۰VӊEpY]BS5F"OD Xc\mzW s? vi2mȵg/]<(`B>c`8Nx_>~`q/=^O[m@گShv wM.ƻ:`L3H]..Є!} 猾5c/Lcve =(cL7fi .r):iҬ:T[rM >3-[-;%!?a2x77m?ȾAt D]A3hK{RcCϲ&܏|p#dȇǾQ?wO_DžIgj}ilXn87S4mjǜp3~4E5=~GЈ52vNx  v=<x|xU#f܊Ž/>ih ~}~}8n~6äz?G(;y;Qkc!ϙTC{&zM{o|4It?a1|Z!͑ǽ=MqKz 6A 뾏 "0j 0ծ +#JOrEPi1`q n}ESX&~ уH}/#oޘ:ƀe{f⥧ٜ]wr<}pqX=>LU?= k gӰ?һaM=e4>0ј0Cm[]ۍv]|?k}`~bst}`~?G}`~f艄x Q菘zE#C1f;Z\_uO >+0n̠|.wٙL{1/d LL;ί ]r#`M y|(cOb:,2to-w)+یz!r6#>$b1ge#C>\CE\9ܣUkdVZ{.0qMr/-p-1;_4]p^۩ cvvv[9'g/ɨ{+Cw0 Dd߈=wS13n> E3pox_ɝo ^Xbow i#O!w,1clw,p'}h[bvmep`?D>v־Z3エ0LFY|{};VfCYm1fwZη4lI: A@{3D[lfGvv 1_枧ٔ}4b>8 ?m4Bhm{t^0]8< ט^4w wt!߰6_;֝Yĺ8Pw:Onޤ~ϹJPE({av>u >7,g!}Z'o)⽤}ڰv {a(!N+O8 :Z>X=i\frߵ9DLLVOu1ۇzCmUšNr x=h N0(5ya?pk¢h< |5NJulƕ%pFcuFт7 K$ė:Vz h@Ѐ4 h@R_##vP؀ck=,Ќp"JKz?* eF]xRK8F&^FBpQK[Y?l1TK1~-4S#38q|q%>;4_KhiVw-W7ҸRwf0Ҭ>hRtSiFHZ:AI#ru/י\g^:u묋ٳ.=`$x à&xzeSa/ԫu=,WuZow7<-R 0D!SDh%mcQ1MF"t6[܃[~=5kϲC:7N}ccQD:sY?v-wV:Uecc|f*;z2ümn]:/6;Z 5`6aXV&֙S5nq ôgufhgcgW@ -KosEQ7zu,m죵ї``T6YHi+E(mSz8\k{@7:%%Ȋ)#uО5~~@iZ`>=0]dן7+GK5Vq|yytQMϣi=+}GJ׭~]nW:`32U{GnY\0g6z:ӑ֗bU&Ӵlӵٌռk ylzY7Hc9˙V5.LWϓ-=hb WXi5ŰoZZz^'L߃EzZ< eHYߪF] eF[Ӗ4f,꤭hW}cԸߕ͂$cjZP?:%Cns\77!w |8X*`"a`bLi_?e0. X60u!lƨq;<;}]2zTeoFKr\۠˃vhM; ׷7F}qw h  0B!r8jQcw /& J`>LG0c6́0X^%P KaeV ĈaxVjx㰎PxD 63-1/K2^`]:ox ކw` C:}'p>p>| _p p|?9*/taRZ妡nHBʒTRƲI eKH'{,{wH/˓+k4:{tﱣMҶնӶvvvvvvvvZm֦MӦkڞ Cuj],m/m֭hs>ھ~ځA<`P0pH(hX8mvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv@Ij7khjikwhwjwiwkhjikhj5]=============t4!.#2 $`2 %d)2,M!˒d9r?y|H>"Oȧ39|I"_oȷ;=H~"?_ȯ7;I"ȿdޤk:uMn>@Cz>L_Z_F_V//#UjZ(}m}}]}=:]%W 뉞c--qx}k}}>Qooo﮷)TMCO=z>SԻY^l[{s}}y!aQ>X8}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~@I7wwwwg;{CQ1q I)iY9yE%eU5u M-m]=}C#cS3s K+k[;{G'gW7wO/o_}dh1t0La1h 2CF1XXXn,g,o`F++#UՌՍ55Q:ƺzF n0lTNclaF-[UFb&ƦXclm1olmlcL0&m]]݌ݍVc1Řj{ӌF10fF1˘mt=cocqqq1888888888888Θoo`hdlbjfnaiemckgo\`\h\d\l\b\j\f\n\a\i\e\m\c\k\g\o`h,0n2z-ƭmƝ]=ƽ}ƃC#ƣcƓS3Ƴs ƋK+ƫkƛ[;ƻ{ƇG'ƧgƗW7ƷwƏO/ƯoƟ_?ƿ"Lba&5-65=s9d6Cfs)s9\\\\l1G++#U55͵Q:zfMn0C32Kf٬1fլu36357175ǚ[[[6s9l5'S̩f9͜n{3siv̽fc16̃CC##̣ͣcc I)iY9yE%eU5u &\hlbjfnaiemckgo>`>h>d>l>b>j>f>n>a>i>e>m>c>k>g>o`hdlbjfnaiemckgo~`~h~d~l~b~j~f~n~a~i~e~m~c~k~g~o`hdlbjfnaiemck.MTԠ&Ԣ6uK=h :Ci3]Ket8].OW+:DWБtU]AפkQtm]GԧTАFD˴Bק Ftc:UZuӄt)K7-t+:[m:Nt#݉LwNSTFtN3hI;iEi7st.݇K :Lz$=M|z<=HO'S4z:=IϢgs^H/K2z9^IWk:z=HЛh/]Ho[mvzE{}~}>DGcq}>Egsy}D_Wku}Eߦw{}~D?Ogs~Eow{D_owE",ba,˶˵>>>>>>>>>>>Ξoo`hdlbjfnaiemckgo_`_h_d_l_b_j_f_n_a_i_e_m_c_k_g_o`h/o{-m]=}C#cS3s K+k[;{G'gW7wO/o_?"u,vu<9g3 v8Cfg)g3YYYYiqF8+9+;8#U՜՝55Q:κzNpB'rJN٩8;8:9;1Nթ9u'v'u6q6u:9;[8[:[96g3iu&;SN3͙;{:3gt9Nqv:8:9;8:9󜃝CCÜÝ##cc ΉI)ΩiΙY9ιy΅E%ΥeΕU5εu ΍&Y<<<<<<<<<<<<<<<<||||||||||||||||,r\%Rrmq]s[pA`w;mvrK˸˺w;]]]]]]]n 7t#݊;Vݚ[wc7qSwwSw;nnNp'mݝܝ]]Vw;ŝ궹{n;pgn;˝v=wow{{{;============Ν^^^^^^^^^^^^^^^^.por{݅-m]=}C#cS3s K+k[;{G'gW7wO/o_?"<,].bKإ2v9]ɮbWkص:v=X/[nf[mvvf{}~{=fGcq{=Şfϰgsy{^fWku{fw{}}>fOgs}žf߰ow{~f_owf٢BSA+^0 f]p n+B000000\X0ta² V(Xh)(TXJadaj k,UUXNazb/BPJrRXAaF c BP/ą6)lZ[جya– [)L(L,L*l[خήΙgwN3gv5Xv}K^d7VSDgF[U6jmHOiI QjCѪ!h2v4ʎ~al1Э_w6VV9mf76bB_4~qȀNl43m(TΜjNӪnv̚jNmifuwdwO٪gMo/6{J충;}t+uvϙ6k6֝uGnF:[guu5l?)]Sw6˰CV!k YOݮYmttXՙSgkCz)̙GG>ޔY5+&9֘#YAMrNoW7<6nⲱ1 k,FՎQm1 m}*iP[gGk)m )BHO:mta(C]aɛJwD'hO߉NjƉNBsFsO‰n}nCⲙMinO ۪V5iֶ~h(w-.;]=mmti[mJ4jmۺۻDwh4ܷ_wV3$FGV'=mS,ڧMzgQh[YwEbJWSu \]?r}_dIC줧QBwKrq3ۦ5 nϚُ`2u7~c>}歳ffs䩭d9d9dv d|.sB:^ޮngcsr[=`SgEp֕sWK]~MEC2 Ke dYL SEH.L\>p>aZLi?>?~|_+/////-C 7.<7n!pC|+ _嚠4M}gMK,Ye!,eB( 9nzNswuhܵwD9em]s~_}%WW|Y \C!W+r9 @oT>$ e2,A!+Ud2L ӆkkkk:::5\h!J(J( T%l\L>!dY,CV ku2lPXnuց>c\1c\1c\1W!111 'O?~ 7E)Mo*&Zp~}jʕ(庼i2YA!c2mkLrR@dp '##п@6\E&ѿ@ /пy 6kc 2lK?#)k")9zEPR@d YBb\QPR 1CzJ)/}YȂ1"K*52U{=)Upa*#nTɗ흭꠽Glh^G+ͪ&#/;X_vJA7G_#;XGvS4<7Osuk89.ϒBIʲQ@dρ9=gddÞ=>uu:|d>2#c.#c>2#c>2?~  'O?~ 'O?~-Re R R JUkNpo9/b8HuEЎIs<@ea****K,rrrh(Zy-߼oyr1*|8<7y3f i"WA~ABvx!7"3'|0s*ϩ ? 0Ry)߼og[mA~mAyAyaA~ !ggw|so*wUU*wUU*wUU*wUU*M%J*n\ඉ9"sD]S\E[mE-g]U[5t_BETR*Ud)(J\URF0( 0 C( 0 C( 0F0B*Pa #TF0")HaD #Rˆ"6!7gݹ2\=(Bm ´ ´ ´IQ~BF%2d YCƐ dcO \ \ \ \ \ \ \ \ \ \pmpmpm\pm=]pmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpmpl=jplplplplplplW+fJ|p~~~$(JwH4RUI_*Ja N'N'$~z.˪UIF_V/ї 0* (JPQPA@9B#P^A` SA`R}sQF(@Q (E5!( DD"*qU TIRJD% Dd2.#SC$OW*~HgHg#kňZE/"Q(BU${2,C}!"bUDĪRJǸ1t+*68gykk#b%uJ”qB,גB.~JWW$/˞q!2QT!C.+=5mj EUXr %~e-cBt=R6%*ׄF\J%[ye̯$c9VշZ7jpًg.PAeՂ@[S5r oY1Nj FB규ʂ_j&Y]PQιJU(Tk u%7 7 U / ~%9XըsPH$FYy@޳TQ+oRUZ|ߙ z+,\ _6\* f_ $o%E!UuUQ J TI콮j}9jo b\ʻ$wj'IQMQI@TeTkڹIAT@+%>ԕPJVFvk2^MLG55pqI[jfMը}P4!s355BzL.ԽVz)^ XȑF\y5!s]:fI"1 7X[Eu#dF:CxFu5e3G]z SU#DKdWW-s,%F/ H+򻑼:FlߍߍߍdZ (~T^PZ%!v~QZS5BBUvZW5eURUf&S3.\.TZ_$һP]$JBy*J* *J"'ʱ|7u )"SD6(G.\H"r!EB)"SD6lL٘"1>}|>}|?~?~!C?~!C?~#,ԏ#G?~#G/K/K/K/K/2+2+2+2+2|*8 Χ|*8 + '?JaRث*JaRث*JaRث(CƐ dRث*JaRث*}JaRا)}JaRأ(=JaRأ(=JaRأ(=JaRأK<Q {G)Q {G)Q {G)Q {G)Q {G)Q {?)O ?)O {ޤ7)M {ޤ7)M ;¾=IaORؓ$=IaORؓ$=IaORؓ$=IaORؓ$=IaORؓ$=IaORؓ$=IaORؓ$=IaO2+\ 2`oR؛&IaoR؛&-K##UU_^xȭUUW^xKȭCCx>v񴃏<<<<|<$O=xG.G.3ï:::T*|􅏧/|<} OῊ H&cr+8E<[~oq-8[~oq-8_KˈC/q%KK~q!?8C~+{q6*U ##K<g#k<`p<H G@Gap<;x#\̝s- G~/?^> |_~ %cɌ<ǒx%cqx,8<X8-Ãqx0&Ãqx08<` |d}8<Ghãqx48<Gh-E`X=E`X=E`X=Eb,z,z,z,z,z,zz*z*s|z*"# z*z*z*z*z*z*z*z*z*z*z*z*z*z*z*z*))),F?}7}'}'O`'XщlaE'X Vt+:N`E'X Vt+:N@^@^@^@^@E,vX<z.z.z.z.z-z-z-z-z-z-2XXs0XXXrYX]BBɩ,,"ͅdp*ozFH>MVU>8 ~A>We;35 `$(5 `X3! `X,5 " `jcűoqhqhq8[&7vrh'vrh'vrh'vrh'vrh'6rh!rh!rh!ǾC9C9C9C9C8C8C8C8C8ërxU>>Y'J\URJ%U*aIaFIaFIaҪPiU*TZ* VJ²(+(+PFEaTFEaTFEaTFEaTFEaNv;DjURJ%U*0|+ _a W0 C"{T-RH"{T-RH"{T-R{H"{T- F0!PBa!PBa!PF0B*Pa #THy|p|8 / A*%|M2hL*| WGJam"\R7|sJoyy <7*E7!*|0<7PGQy |Ry)߼ry9߼o^Ae%jZzGbTqyo27O͓|iyo{V) 34(?Ca2oQ~FQ~FghghQ~FQ~FghghQ~FQ~FghghQ~FQ~FghU+|sݨo^7cVGYaVG|%nQ~Fn55555555555555555>>66666666666666666666666666666666666666666666666666666ƛgcacacacacacacacacacacacaca:E!PI踂S*X?P_C}M7U_]==[oOf>)z} ?pp/*qهetUZwjΡ(H=3Y\B:v?%-h E鯲U0WY*K_e ,a|;z?um'EK/ZB[+7pXv,;`rc9رXv,;˅aW@ u@-]C`! >{cccccVyeax(ǻG9=R !#dYA6v)ixjɗ Y6d#BIi7?ٴl<>eSv=1*́}۝/CCPCP!!!!!!a q>W>bb!fzb!fzb!fz8;b!b|:b!b!b!b0!!!!!!!b!XF!XFx9A^>D^>D^>D^>D^>D)D!D^>D^>D^>D^>((((D>D>((((D^?a)BX,,,,,,,,,l:yŪ8?7Mܭ4њ&sRћFk4c,_ YaUDyFa3(sFk,,*V]eD.< K Ca`\_XwQXqFauBJ ^OK/@]Am[Pp C{ޱmXI(l5$A^Ga5#WCֻz Ca`Xke{[V7+:daMdH2~n &( @"|KP5h;t( hKeV״^ޒA!C k4p5Cfˤ&G9weP8(GMZb.,ica'{!/ѻF(lYpڮxu1uWXkH_5/_h9Vo-ȦpM -&M lYy`1oXMcZeE_|W[zP˷٧1i8e̛ـGW_r++Y'X'*'5qm-og3ž#^tF#O3_0֘[ڳso'ܝ}vp˝w,rKV-e۳X6=eqO=F/R>cpp [%-"#Y);G8k,^6+;;[ '`}4g`ta`jWL3 i#N_p:}ۉN$#x2bƘiOjŝ4ow2 nOhcj7ewfAR-76n!\}kZmrMYkik3eB#--+<|d˅Z[ ?q8޼rcC7mYy#ZC ?!Ƭ!y~>y٧Y߼{f8@k@-o=m֥nӞӾilr4i^ӍM5=]Ӣ&uJ-@ι_qwpNߟ\[˾naTbd_7Q! endstream endobj 569 0 obj << /Length 406 /Filter /FlateDecode >> stream x]ۊ0{"Wj {`B% +Xd2I'nTV~oIF;ˤaCߺqvqvҔ_6x_^y\^ae&}a/͠:>ncY5ڄoݔ ob죔~}ze:}QN'cO(=Ǵt ;)P (B(bNJ ␄PYj Q@-!j1@,DerRX-AB+ĴH(giA'F1d鏪s!: Q V V+DtE%H"($D;uB(蔄$ S"Ջ>m ض+CV-Ϣ[X endstream endobj 570 0 obj << /Type /Font /Subtype /Type0 /Encoding /Identity-H /DescendantFonts [ 571 0 R ] /BaseFont /ACHRDW+BookmanOldStyle-Identity-H /ToUnicode 563 0 R >> endobj 571 0 obj << /Type /Font /Subtype /CIDFontType2 /FontDescriptor 572 0 R /DW 1000 /CIDSystemInfo << /Supplement 0 /Ordering (Identity) /Registry (Softland) >> /CIDToGIDMap /Identity /BaseFont /AUQYIQ+BookmanOldStyle /W [ 0 [ 750 ] 3 [ 320 ] ] >> endobj 572 0 obj << /Type /FontDescriptor /FontName /AUQYIQ+BookmanOldStyle /Ascent 716 /CapHeight 716 /Descent -225 /Flags 32 /FontBBox [ -186 -318 1317 992 ] /ItalicAngle 0 /StemV 71 /XHeight 472 /CIDSet 561 0 R /FontFile2 573 0 R >> endobj 573 0 obj << /Length1 11084 /Filter /FlateDecode /Length 5412 >> stream xZ{|E>U=3IH g Ix#&LDȃ2`8@XIPH@QQAdٞ{wrW>XwE W%}ꙉ]wtsTsyUu7bDE$ȼY#FTWlUMzzVTߵsC{Z7^B~ȯ{`6Q7V;#GcxoY>FڥUe޼G |M-6̓ y[uUM5b\/m((b1"K!fe fbv*xOp +¹L.׌y ٔc8m#j9{Zp FD0tdj?Q"iy+e=K'f->U7O}TD cޣ+tT*4rrh oX.iޤ1lVC&ZGu%mi-3 YG[0 "FZJj@Zq-x> (ÆTAҟڽKi>=A*Cl7 ;M,Ci3KG.FYZ [VNK_!:AIcX?n6i#ZvzPV xsxV|[?%Qk)iȦiT1mG)Ds/ʦ<'nOxv"(&S:l1,WGya?_tET6sn煼%M$GkvH3ks)JՌuP Bܓi~g!#7Z2UC>7†hݸ~F܎q'z>QQ3pw0E7g}(B6Ujv{=Ξe{Lefه|"+6?RdKӥiUzD'}%y34^K/㕨|?C& 풶IOH{%UH60y\'W+!CqnC5Ƶx=br/#!Ǒ.AKT\ vJ);IMQojГ]3y[X!(zf4~lM>Xϊbve+H3&HI<c⤉Ə3zSS% 2x@Dm3&GwsѠgg{l`*O*v/.j)zlK: Yq#(dѶ4JKM6i9%os63?C˃D̰}N<68e*LM!dQj?˞vMs2acwv0A 3!1ѝ2jd]eTCjԗ-P͟rakk4-$w[h_--Q%[fw0>5=WTFd2**i?tzf旕A % = [HM6bCCݖij h{?7 ԪhLP[>cP{eH  Y܂9%6W'e>_ xo~Ene2R1Ư%" J+$#$L:a_6t@>WhT&zWɁ!>0o b'CP{O:My:ӵA߫tC> u~ +t#@ gm7+Oastyimq)OkWER&/Xz81܇_A+˔^> o40 b[T^ EGQ_>m3X±F\hȟ r٨}=&0B]Y;D-*x؆~ ?-R#ӑWED&&BuĀ/p r?Q;x,m:Qb\ȈZFH$lj:5"^~:k-w^Ы[c +ԍzmPWW QY)SA:5$>{V+ahcӉkOT(/ yM?vnpUѠOq^|HӐ VL x)zOC- 8.Y 1^aˏ`8gyKyp*{QG:q׾~LR8ΞP.:cCqAoTgzZIZσBa h}t0J;i8Wh'I]{7|CO|:ljX}z O$}b`_@>I!l3Hq `Hb6ޥW(O\.Oz{lо_FL %(=t4ޣdy# <41U_KwAY}.|1En W/ ӨsR!N[#tIL^(fޮ DZ3VFEPti;1r轄KcBGr3z]_% {r2 M/ X+HwgO!CivùgFӡ}:JӱF#_]+txN/>gp?h b6 ͔.r|~o6 'x"%klX s"3.U ,+_F}z4|yP]/[~3`S{Tz4XOET>&b#3%;|BMzOy߼o7x3N_RUBiM7(L<ѺekWOvyݼn^7/[V.@!ݖ%#5XyN>ҙmUb`k+ uC$ p9no^+Mͫ_+֎~QJT8÷v먎ǹbŎĞi 9̲d{MF {j) K^A '9Y,ezƘy5df;vw3,,"3%z-KŘoz[13bYl>Xloz`Ѳmzkvt77՛7UoWy"RoB#6{c]fm"SE֌xޓ*d1Tɛ:G:' 7:&‰vbicߡ&oѩ0.}\d b8I_Je˰ P|op9V+ %| C l U KYzHdj acrYݡ[.T o 3,[YA8wYN @MA;@w!o.vtϋ<{'!'AxAF@eXZr,+!!ooY,c)Vht)ЂpFsF-D4jO.#bhzZM[ZZrjLa;GOzNlZX2F^͇-tU[{=>'aSyh-/ljf늇[벇b*cfKv>;""2"kd&Fo606]2666UJMwJML6-~xki6u7u3EL&I6tryL(6,{+,*L̥ܢxuBrn ɹ1?cUYqM w6blӦm kݔUy"tɊCfAhN9J-?Xnү+{FoW4Zk; &٤3)Ȍ>;D߭?șe+-i+xƗ .ic WNwyAva5W5v˅F!*!!r*_Uxu/tFN׫Kw:!̻z|>ȴ~ ۃv};ȧc ªs[WHUvb6RW6Vf|vbUj!IJ ~O̮ aUgxrGm\Wlm `ς2^T}NuiW!_=+vκJg@e:/}r[BYXkabbbZ̵H%~eJ $$3-S>91~}^Jv왪 X%.$Ċ_?91bEӦKH./|ѣN " ;kj̫UK53o+YMJ endstream endobj 574 0 obj << /Type /Font /Subtype /Type0 /Encoding /Identity-H /DescendantFonts [ 575 0 R ] /BaseFont /BKLULQ+Arial-BoldMT-Identity-H /ToUnicode 579 0 R >> endobj 575 0 obj << /Type /Font /Subtype /CIDFontType2 /FontDescriptor 576 0 R /DW 1000 /CIDSystemInfo << /Supplement 0 /Ordering (Identity) /Registry (Softland) >> /CIDToGIDMap /Identity /BaseFont /ASCNGX+Arial-BoldMT /W [ 0 [ 750 ] 3 [ 278 ] 8 [ 889 ] 11 [ 333 333 ] 16 [ 333 278 ] 19 [ 556 556 556 556 556 556 556 556 556 556 ] 30 [ 333 ] 32 [ 584 ] 36 [ 722 722 722 722 667 611 778 722 ] 45 [ 556 722 611 833 722 778 667 ] 53 [ 722 667 611 ] 57 [ 667 944 ] 60 [ 667 611 ] 68 [ 556 611 556 611 556 333 611 611 278 278 556 278 889 611 611 611 611 389 556 333 611 ] 90 [ 778 556 556 500 ] 177 [ 556 ] 761 [ 562 562 562 562 562 562 562 562 562 562 ] 899 [ 217 ] 903 [ 217 ] 909 [ 217 234 649 ] 913 [ 271 ] 915 [ 343 415 649 ] 919 [ 271 ] 925 [ 577 559 523 ] 930 [ 559 523 ] 935 [ 523 ] 937 [ 343 ] 941 [ 433 ] 943 [ 433 ] 945 [ 899 ] 947 [ 608 ] 951 [ 608 ] 955 [ 771 ] 957 [ 1063 ] 959 [ 771 ] 961 [ 523 ] 969 [ 541 469 541 360 ] 975 [ 541 360 758 ] 979 [ 305 324 612 ] 983 [ 305 324 541 ] 987 [ 360 ] 989 [ 451 ] 991 [ 234 234 360 ] 995 [ 415 ] 997 [ 541 ] 999 [ 271 ] 1001 [ 343 415 ] 1004 [ 451 451 ] 1009 [ 645 577 271 ] 1015 [ 486 ] ] >> endobj 576 0 obj << /Type /FontDescriptor /FontName /ASCNGX+Arial-BoldMT /Ascent 728 /CapHeight 716 /Descent -210 /Flags 262176 /FontBBox [ -628 -376 2000 1018 ] /ItalicAngle 0 /StemV 165 /XHeight 519 /CIDSet 577 0 R /FontFile2 578 0 R >> endobj 577 0 obj << /Filter /FlateDecode /Length 26 >> stream xqW9a8 vt endstream endobj 578 0 obj << /Length1 125133 /Filter /FlateDecode /Length 60916 >> stream xi`E6\UwOϾ'd $$B f@=a_\ & De7E(.aW]@Q@PAD"If=~y}N]uUwaJedʇU{$ J:r_CF(4B1XP/uߘA(#{}NUEt6<PNw \r*8rp3<3&:n$~) _{[яLxGGA{g4y_{#|!g>'xi&~6.SGb"q4Q?݇ft|Huě(Bt2SѐR[D;ڢ8J|Abj"5M-RSRWi.f,yRcl;v(Ly'0'ᙄ~Mkzݼe!r,[wG'xx#>/ї}|9'|[}~o;d+oP\WI"hH4'݉GHQuActI`8+X\\|<|`]pWC?$'+ɝ+G&I3yb[9/m m:6tjڰBCqDSAoM@1ڨZ\MM**P3`eԋaK7(s"V%~Va+yI@ U`߼ݽ%͖n n˥|y7-7,W}rf˭i9XΕlQ|r%7-"Xpr厃ݴ `Jcih S46mhlQ/RZ.= >bZWS0!C]Ə! __z!tq^~vrtpQ(]/ E"u\D?#ҹg3/MRgf!tz]3.>u+Y ,Au굧T~3 J(dtd'N9}2d'NZO?xN|^u'{N|bn':t"D s٩p53X_ lGk'Q#U{7RRHW2l#l7Į`k÷'넳jmDVꖺZzF|^TeͥrqrNoq;5nJd yPeh z^BF0z]FG*ca~Aϡ w^@AFhFЧ#1GctFog(}q h<ݍBj4UIh2MES44f>t?@h ރ't +*L0i̠Ԉ«Ԅ"QZ\u"x^_ 5:~7 o[u^V oǵXza6b63[lV6lKn~6v`'ڈj ;]' Cc/a?NC?8‡>?Gu88 Ebv }].gWOO+USL}caװϲϱkjyE%ev@ɾ¾n`_c_g`d75&v3}ncbw{ؽ>v?6.{=ȾǾ~~~~~~bӍt b0Ca=~e`_ٯدI {=~~~Ϟeϱ?b/zg| d挜3s8;9y9%dlA:-Jҏ?tWutu5uM.*#˄ pI\KRTƅd\ 07p Ebn {[-VprqsOpOc4VqOq!=Y9n-W=ϽȽB_%:Ž̭spr׸׹77\ mJN%8)^H WI~)Q HIRPJRT1q3=wm;߃|1_~ ?/+'RҥR+)Cʔ.H?IKRZʒGer~(8$_?ůkeJe%_e+>ÿ+*?_8p#n\  "4aK8%DO HLL,Ċ[ II\MH<ζG"nHg$$$$#NJ_ү{$$H$I&aCڐ\}2O l2TCa2?$#cS??_I ?ϟ?%&wWkuO/,bo3ccelqQ X q @ GM`,`d|IdI0 *Kp qBBY!($ )BBHBB:B+!CZ YBr6BV1L^:A: .BWP(&.&t9Y%Y'z EB/P,}B?0@( JeY( !B0T&TÅHa0Z# +N.na0I& S4YFQyӑQLWdz3}` eF0c =dfdf3UC3 RfyySP!9yyyab1uNf/hC%s9fZ3癋/5XkaEz@'Il2ʦl+6a04SGٮvc l'[b{l ۇc؁ -cÑ!&i P"%Q}; v;/muzYg׹u D].UKeº|뮻]W+ݡЍҍM%}#;e>-NH")9Q%Q'ʢ^4F$EhU}n>I#gQs t\H.Eڄ6F[6>лAڏPAEGe{j 5*QňDpDI4GF$t%N2J&ݧCú#d5Ze.@q'< ?Ï? GNOˉr@Nr"-rOH]NCrRn%gșrkW'Yr|H>"Oȧ9LQ 9Mΐow{r#?~Lf|JdF1L 0?`132ޏOOe0S'&2J*JZPi30/w,X2 Q#R-VTIl* \_bꙟFY'>ȿH%@y'y3̷w -#R#BL!ɶ whL *jCN]âؒ|`DͰ/N&j;.w\'')-B-[edm׮}~J]v+{E]\ҧo*-<*#G3v wu='UNwig7f͞SCϝ7E,}d>O\њg[[ /57Xi󖷶n^n{ۏyÏ>Cёώ~ű/W_8yFͿk4}y5h]w5h]w5h]w5kzO'#P-ѳ7Y@yb[g30/9rH[F@l$h%0$dGP.BK3i z ݎnˁ_|Ccz_ΡӈG ڣ؎:6<@{pW+1:NF+VP;1P"ZLBc(Ryaz $֑r  =1-!68s9zE_~] ]TDRL&eDGtݙa 74<y#r$=zOF`/F{ }~=]  zo"iO]'`ej "C%T [CRh#L[`Y "+keQ$GsҚȸHMd `$K<u#b'h֏"_(\QpKvB\{A<?@T| ?Mi" NNF\-A,;Fzh @hMSC{S\u:OHè9z*=^Mߢ@/942,al<1;p%;>~'Ln>@6+=C=8Pzf#.ڢ^*t \?D9 #DAIr~tU\]zCGA4ZAv3z䓁d 9 :xw{kóp.>'v/Ty|A Ѓ(4^y$y >բ0Uf QCY xԨW~6.zK]rَLt"x9hn%xxzn <d7"Ē,4B =>/:}/\ Q W}}">v g̴X5X{.zYDGOal\(m.RFF]MM8޹'¯<[|2ĉ;t;E`ap:Q; ]~q[2/t֎jJߺQp6o؆ v>{'a#Kp]xyP=&(=;ږvjP\ 0@? H_hQL53jz.zDq]N۷kjѪez(EjJr0)y*95 4?T1q;Sy&6Q~t_擮_-ܧ(kھ ~?\W+|j [ܭ+&I2Zl6JWLڄCm"Q5@n5@W5TQ5%}JuZ.##jPs!hapm|ޠ%M/5!ݨwP{Bp߮5g]Jz4Z9ާ/^ק֣~5-+߀kIbq!z)F敕ypKWtSk*&j@*`h܋kPneG rw-_ʆwdE޷ť\<2}3&yG'ߺ31mO;]+{ӲXmQ7-) @ڪhȶp|0\U3 Fd|ХbZ^_? P5Ûkؠ8 58~c&IKS!u16v9-ӧՒ6IFd`>T^.VA#PSէ4Vq*!}7GnyyEV'g0-Ƶ~>K}W4۶?Jmokޫt)H;nJu5tGPJ kcikj9jի˚[Y.r:b K'/qŅ_kU#>c`_<[ō-)\ZX )٤0"[ؿt3KEMIptE%7kՒO-" @LxP*(Uh呵iu:F֒XQOKDԱg C"8r@ PHF.e"څL؉!+Q!i7MAH0FQQ;}mʢQ]qȋB 6+qǓų7 mGYOp7XVcpd|9'ވt~A,bF×uXwG1L{uq彚+[yNnP=U>,$&s͜% Zgmi ΂9 $&Z69@"7X[|>Wt#{XN?.9gA_:)gi9ppϞa%;#}8*TzF8 C({Gg҄%+^S+zTP`7ˆrH&9FKlBlVNF_]=r}v Dǿ]U@ +όQ[Zh-8SH8Wވ٨ 6`ޕ"'υesgmt4u5dAab<NjA(%Zz6^ƭUj^T^v"1#X@ndLN&Y_Xb"A]bc勺""VbY۶BwG(]`vX0~2@@Nr?Y>ը- c0SKn#vR& K]b^!f^j4-ȿR^:&iM%G?}L2ҁݢIW0Zʰmq9;.q]xtnۇR\wwOr&ܔ=H/t[Ƴ!~7#Lu\V[C:GQ#TKBP*.CGtYL#p8n m!d< 8T^EP9̔;'o)Omf)zc)/}6KRE\q$΂Uk҂_y>Q0x<3m۶-Õ9 ȱ\MR,r,r1X}iOq|G~u^ّ1ix '6 0t7GnJI:JW`Zl%d*޺cYvrv+~EaQ'$EW,cE^.YZLגa!ռuq o5`,ץ5}0:rZF^/=/NIc:>\i7J;My&j^KLy&U FrKP-z\;,ULqvHP 16ʓ >o"="MqwsߡYc^"yq̝49j*25o9'0.*"Vt>9Oйt!]?ݝtlYNTD%C^)C"RT,QcNC`u< P”[kB:Ӏ?6iӬ^p$Ko6O S#=#q&'`_DI([3y7\;޳||SӬsT2JӵAuv=HXmzʂUSΗW%OYjt||z*T|`/$AVŭH: } O' CYs"NLURIj-Yf 8$W'5n:NMZ@WM!6CMNL*C!sC?hq$U[ Dݲ=#'T̜iyN1bX>e&O);rzc^6?pC/VaCLe`txX)mo*2fWWuuhU_kzr}hg1-2yºՎSVfǜΩ1}sf X8-\nvs2#Sv/6c;S-y&/y, k : kiv-FA3M־рONȱ_^ շXω_Bt46EGFN/\ye";t2݀Q։zjY'(A4m)&II1k,L{ƫ~R_q"`6mrUQ]iSNRZ>$ߔQG@%f +ឹ,&U\ܶĔpY@TY<YX} keMnOX bi.ErixPK+k $I"ԑ$DԉK:s`bu6ic/u x(_JzwA+q+o aAJTj~E5 }a<-E#`M,ݶm3׎1u/[(SմA}xla_uMg%X~X#W qi?WiZ65bɴmH -ĈĥLbXl8A }Y :ҪUEIZhU݊ʄjM!%(v-Ye~7DZʫIVM TE6{lTqY&N[<9f+jڟ@nL mFɔe7+I7_[0x+ʟ3r."ԷH}PQ#:Թr߇LƾJ5gJ'0趮iGd+4U g2GSzYעϩϥ?(!(RTa>s8-HdTf5J: 1Xc_#gep&gXEK-8-i^a}0V'! zLU-E~ i?΄͖Ra2om&+mLp~6N*p91ՀI`o'"'# L+"'/O{m qC._`|~rКsJ56<5"/dM1iuK:)u5R^4f]SIW9޴kK:UHlRuR zdFzEFN.=hh `iav<Ɋ3*457W}/cef`  b)ACdNO;_我}aZ6/f+7CVQ-U˾BH_eElTWK ABͧVS T%S"ALpLC qY*`k?*T@gvHt' %\\pIZ|f-licǙVeMIaě%M$5DH> eMĠS׹iO3nPڞmQK ٪Pm{wy55AYUtĩH'K > \ۅE_a͚͹R|+ }/\뉢F+H:2ıd=Z N'3藄 VN*%+AKr>&|%'?焟Dy0C|,+W*&8q溒"P$ "3aҎ =. ڈv\ % X.K{(C^KjR}JXRZTI8*v Ug?W+j핖p BVlHE%3&DN%pWXޢRGڪ!aFũ_0)(|F[ŌRDI(˫eY|+ ICn24@ Ju-N󼘳ݢՁ $T)P}*'E@j GN,bGNE|IW!PluL='SE/P,*Sb1j-_Mmk9adk"gdOM8kԬR0vvaJ㜄rp$kOD 9J^4Q|?Ifp ,C7>ʐ5`SGJ%e&@K_ԮƮ*.tšUS49=o)t3746^/3/.-t,tw83 m3nYZʂ%GS6Fc;/ӣx*<YgeAghj+Zϯ gC^]hIAq)l =I dHoj +Zp[hQ@}#㖧,W eo^?uXT+L[5LE+fMyCbB~q3u>mVoZCN*sQgwaSg[t ͌Nΐ~;ЕtccSǦOuN\r$ O++&>6Ĥ@Er. }EuzD EMd.%Ā(1Щ|N<ѹIud4(aZZ)][\Wj\aL+<#i;#(Rݭ)PESl]-?k|QMHi[6^<4Y]\ ])Cga.%=<*1o%y jb0>smGE:9Ot%/tƣm[;v!wI, _M'1V [hqԕ^`nb_^V"-f=##-94ui9O?>qVw\92'1/s%OމտGvhk@Ig2%$JX!p,fHxpsTDL4G"((} D Bz)D`TcOU!6昔OQH/Ho:W,U,oAյsFۅ1èDp $駘=06 m\Ac\c'?zܽν#=q:mveOa[\|du{_'))]NRBIJb*$.OxbRcI*X9˙~`Vrnh0@vG@uw[1de86n/u"K'ՂCFn gU"I$:{RN0 TPtxR<1{Wo7h.r\ޥTưc11L9(␺{ԟbX?v$Ҵc&q_sǎ5]~"r>gr!ekHœ־g9} *glJ]HjZb ՝s{9>5;Hj/J~Y-d)M'[KYRݙzV4MHHXs@0Ai0F 8^CŖ%ti-dS :v/o[CUD72oF+Xol:{cjҼv{cGZ㴛o{SuStW-xcB3Xus0vǍy?^TzQp'ޓ:ܠEج=Pv.]c-7”u`3o]'oU7!2=yggX_/nG{q:θ'8$R8$b5-`jT h@%1_Rx@_+N2yI~qb'&mZ؂sm \+'_+ͥ*eW6uho~qW% Pk9ӡyvpyӣ9]omHo:-;-+0P"*F'~P!XV3okFgrD,rH835,´o(C7^{Wq+09v}j,bJ"Z%797Zt9{kLɔ8oF]Ŝ)"Qi3ZB$`nA r?h nu$c:v]V0"ԷEg .|=lqɬ.H)G'ZqxX|ST#\q8K<|"7p7jMt|ZMn+h ï;Y`],^ˉ6n~-aɆk˷@C7ˏ[Iy|xr%[a-;)J1A 9eb* Ȅt"eeV\] ŵ+`(]cKtnT:AOr!\ZU3piFy* oD2k3y88257384|6;5HL5Y!:?rKV6 FTdr EƅEE%1M{;59{?Bg/m[󎘼q;S1f?U;۟G mBFFJك"5Xdqx3Y9f3jo]uJ$XF vCaA08;95;t N;Ic81hOäݔWa97yzV՝0UyA 5t8Μ>bI9!mWyh;rX%×~0sAr9A~+_ZNu喩M:7KCJ-}i|~zsp]ie=64.œt>IIgߒ1񄔌+WW\[~MFϺ=WNX;;US>Qa٧拰T~قtB'igVw,Zꮊ mYn:Ԋdkl_Znsn2ϙV8wrD&f1AKlL= ^cΌ5pdMsIS¹3xCkSo^8z̭f'HQCQo(QAlmis$d#mo a.EI<Պl2965VP|iuowuu~[$n' @pEwjFLwa>fOq6c蠞pC#Q_Wrp2h/Xd2|3 飅)dáw*&oP s'hB\! gCPE3.㎖ Tf\|d2_?ӵWm|px%Hd=-}q2 <坿TmlǹFaF^;uөsupfZ[ru踺BETs:xm*`q x9^b:;(YͿG}4zDcз_{HƘ`P)NnP@guW`*zN pF㛱< zm(6=7{6^+ ~wx*! "kX5pIxLL{ wQNEhĬ˵gwV7pVcEI,R\gda`O6XoY>jr6Ū¶p4w0r7?u{+;.38*ZȦr[˷>id|2A8#v҉P^R\R8eWRݽ9o%.~\tz: oGt3ch7KyV Zg̋VA?p]MW;9h#mWˍ,M*fj=e* n>idc|f_!1е o]@j-ςr^^ϩ5v#]  nnVl&#u&˜΅f~1JҩhJnǶV8[)=i(']^`ӌ|J薤O$$-Qq9;W<9ǻgŘ-CGzY6('. ǽw-Li@t#oui*O+Y?yʈ^FSԞK*+3\M7Wł {?0 hkjRɴu?)d Xӽо^A{+di8į@?Q1=#zGH% ˢ>(.9Z)q[f]ΈqbȔ&'M(pA~0 'YVO5ZhRU)\u_C2$tFSC.mX1N@d7,lG5t:ƹˠ4n<%f1.)ɐYb tFK'fwA eRg ]!QXqa3egP/$4G*fݎZ*y>ZNUEa WŬU\3xH-RT?EeNoS>z6I&AN.rIjC x= /fė% <6]YW'㊠AoUCsF]_»zŊ2bCT`4xTe`2ŨXx%g?/ݑy,_Rk{#0*:zk%wE/ASsMK.n~5a;7!* U&xHI sւc`z*ψ bX6٢P&x W8=fE\Wr͔WJ:UT=@x~tA \h6\e]Tbk0q!_W(c}I%H))~\K% %%ox\l n_)H \Ƅ j`8Qu*X_qb@Ϸ\ s,+ 41J_յj$`nkK-n\LG$Y 4j&;̌)xJ%KmƔdոH@I|j/^wqon }Un+kJN[!ĒjjqZi3jF)1/*@rrQ|UCgPՂ:{eU wZVx>E$BJBI"t6} 5R5Ri($TVxA{@{ېKl+Ρ47TDuhs{ ڛ&OU&S_jipo*.?7]y_;tu8%58'ʠ#md}<3>.z/wb:DWυ5tG (G. ~zRVe/Dcxߦ,GA7.N٬? Jk;F#x* *-zέ7f!pz-IPzj <&;zQ ͤ :cxq b¶`uc|o&l҂ )1QyR߸V', jhߛDTϙ:ED)J*u*,lgV%m;y˱;99 ~_ً{;_UE[SoNzoUxњG c,=[y-gG˩tD+ڧ3d6j,# <]]ۂ +"c͸f/Fy~%\Z|>o G<^66.*sxId> \HAW<W}O3gI@1ghN̬rln5 :U+_:{z0[޸aU,3~|kEʈM; n|zyg}8\ʝK-ߑ_Tuz\_8k2:0:C,;eHOcA|B:O?6p_`@poZM" 8kKrLߖq>7bo$OZE +[38ܝ[ 8}V)Y?LڻMmlQ^ob"r'WA~b"d'պ.`M @|9⓻^!!LYj: ` } `#ڄυw\t fD~u?&muk'7nx˄!k}UJ3vr.t g*dQf.u95Z7h<3ɂnڅT+@O%N+3Nsp1ls#D!}XDY-!)\)`IDž,d^@ʕ]=w9]UOt:MQ ~_ڲ|zwf&ƌLr4k$f+^ɞ%7G|2i846! pYpX1vz@g7˝}6QblxS9&ٰ' l7pKX<4 h1qbLGh|rQMWyS['.Zn֕.qaYs 16ζtfKj]^D^O\Gu2%lu:]ҠQ(I &9F/kYz<6/O1`JrVu, y h !1T^wc}0hҝ ӷtv8EPYC~\lz joc?k»˶DilkyC9UrNS%=&ʃ$#>p|][|e2d;R W*Bl*uILd82C5cEi29@n"1v3@*iz~-k _6RoH.R,Ǻ&8O%CMbIjF$pKX2I :-z3Y#v[mfKbC^SI2%~26my4ƜCM7<}gE9uD=0->|׆zSI,N7% eQbbp0R)=f=gǂwK^$G8*C?ґ4>ƱǽVekksx xxdހg+5f 3*ްl4Z-HOȁ!#3VUU )`$fB "A;FcG"WD`k7~C-b)X&1ddEd:5.,vT3}{KcM;0x/yS={]^'O*;W:EݎN4n@%a2 m98k;΃ 3zЫVGD$ NIFƽqs*eU|ad0\=1'=v- iQZT'.+mCƎuE$_.VhqUsc26hE|G],uIL0uRtZ/"Vj('9F0O a$FA>5At o0| 9' 0zªTc au_Y,*Lqm25-<*1̕7mشZBSʈ 1/;J#6n#WΩjvWo|<4yޕ-i53뷉Y0t>i D-aIJhIɜ(2&jA䘙p^̽$NOZH{Q_,̃>e$,:mȷ7bkU\`vOmfSGәoa:*<-r]?i7%zKEzq"%`EZǕ.9Z—bsN: *6i1e%g ~d٤Asp'_d|xʏWяaŻё kyήka\=zPev{ {QY o*v68\f'q'ng+*elVU˙L/#}VبH<_F*WVRZDrT,\ vOY\U9`nh-89ήg.}u?Xwڪ/]%G퍃H`(߫ä 箞A ..+.߶SnMûU1JJScNTcN125%7֜njVb,=%P%&TdH b`3XxM$VE94 Q7)YQZp^Vg~tvz [Ōz-6-Ɲ3:@^TynM4`F4ªplsʫÕdmblz'A'H$A$Yl=ءJSꬄ^r-?)|0TV9[E2}pNN9M Sty#m |Xlr|U]>5aa{w⪨[-,GoV ȽNe+pdRnm+*ɭdyMd m$Rg uJ`}S* p 04|}Fr(ѹY  ՠc̐8s2F%750)0h|4(k4.Reѡ&6XEIBO>^VQ]qFkCO 7t ;` e A &oUU\ٗl\2wy{β@<2mh'Zw ,sL/u[=%2ŠD}Q`<|'`}ђb7AɻfvX*Djp@)0FX4OZtMsxYmƌ?IdBrhK! {Lomh6ܳZ"|D&R:i$?!8^x:5cT(fB̓{Lds@m/Qu8=g?=WT2''gYU/M8ozRaf![S3V-u{NgNi2S̼_5] T+!KMKK.Ꙋ} =<SZAvf }Jy;?)oyW#.D :m"ub>ͪNE%~b<,Y g;HaǛ gXq+HX 8>úWF l ;[I#x7pEÛF^25/U]~XX3͍#P5x%7D}w.\қ~6#T]F2yq]17[7qZ0NxT28V~rNgؽƠ̾ި+EI4WW][]C|+7/#22q#x$_Xf VKVlU55ZYv]\4:ZWy}R1Z5I.dPiz p`g l=J{\-ԇZ{:Ёk&c5=F"$iG**SRgI[wúO,t-V\ԯW\Yxq/Z2wdիFŚ^~i{O^xeClw/aΩřYņ!~OD>3gZltsBIN0P4zg.3Ѱ9ɜabʬd1Z[$ad>ݾ{n-+W/U9 "\lμYQT% l3\4C>\Wokh_: ~Lo_!W $ЁJ\pBk]*1 VWT^07<"^>t|ڏW\NE QZ&~֘<ռes>&,u-7YԲѵz ".|Mͱ| {O-%ؾzK}թn;'ŔU\GW_}ʮާ? vki,"Nv_!B8w90gTؿ n~uck0`5s>Y,Al܃&2ó{$`!8irlo3Z六pHw ^xЦW W (8کN϶a}>ކۀpIf~5 &x/f+ziVi&Џ>w:7L Nدxϻ;πHk0{ _=_ ߽: I< *&[a?*Bmd)h=@$Iq!A]4f,{||@'A\׊xBH u"V~Vx = ό0t%ý({J"OLv =7h]A7A~ Єp+ & j,ldJl@Yrep-g,K[3Ŗ_~"OiD|\br[aVbxA^CyD }ZH%:b-⢷y9Mw'd^~8˒äh9~Pv+t.gm\!2*|$ mzX=-Bs?ϐxs/ʄ [8 `-@>K/]Tbr`fQ!a*xxJL ~Bz*yHt#<xh3x?/"ogPB+B;p =Ǒ#6~ft4*6h*g?>ǟRߢmAl )ǝ~D:ھ>taz 2Kr㐦G]='@F?sJݳ ]kS hKOhvTL>{] gvtDw=b2 (6;'aBx n&qkaN&nv~7rP;}8tVSM؟sxLE ϑH+W:d>_K{a+a+}+4DoGIT g< {~ "o'7a}$(.azL+  TQt==W C|!P8!F݄B<#п)̟x_ 3a#` >\N=3=_õ '2&ʋt%;0˿{d}ca9!*5P-=n*GHEY{ $Fa![;6'7PIZ}Hu^ La2_E=~'vY%g]рk&<ױg|E'y>޵OyW7?vw}O~x_d)-L$<ν~a>sFVӍa5y *h?8 _zh;1.@^ ,F oK'Ռ>\=D.G{}CPI1( odxq8l ᾋB 剂 { *}` OxI[[Iw )Gk =C'I}:߲3?}Dx 1𙧐`NJ\O:+/?}9%v>o !9|BN=6ԏTNC~8ZF_epwo<.Jͯ p?R %p?v ;w3-ʰ?ԯa0S{7T~菜#۞'G[5@: ?"=kmm18>}boq-T|J2GeOR-ZEWh8W>W 0gU#}t+WIx5G5 t [ލ%:/R`ls_z> /[f(ڴn=KǞmWO, 5>A-m}vh`Lﭜm7g~8ټ3A" C=oW޴}0 H9Zܕm=оOG${:gjzUNa=K6~Ϸ3pn x^Z{DžWyz>{}~>_|-y+0ރ}@tϑRk0į Yt:ӭd\rqBLTSϳl Ɗ8 ˭=07$}c?=?s$?!Cp%j9dVa~ 핮kM^![4& +}fU90UѮ a.3''`z牾-N? p3I}NΞ7Z_k#B9{->f ߥ,K|opm NpkǦ0`5sfn'{^|&c%=u.p9?qQ$kl {=dϧdz,<B`~=/i0g@͐%#`<m=e \col| Wo{ ()mu$MlX|fz:! Haw`',;qwwwwwwwww%nWto$'?&U]]O[2)c[>¹p8AutHq}|:rڇGzwl߇HeZBl1Dsv3aR:'81HrZ7 Jn52= t)C4] <4ۨL0:V3 $PZ98gжHF|F_b#PJOƯ?PwT#QRDyFkK9&6Xtݣtރ(߄:kL}~)oUG)KkJgSڦewbT^DV"쐀R6eA)#cw&Ms oˢr/^{S~}Tmj?e_L}D6іF}b zԃZ xkC[#ÙjάO LK#nLV G!~p?Zxty?yO7&\;wa`s/m mõ&d!-OdEHYrsp$\ P#8#S|\r:}.W8>ʇI#/d?V$<%MN6Nac瘈Z̴҄/E@&O=@Ϝ>9/2ZѨ}q+9\.}#<2Od} lwߤ:!x9Lq9)<ׂ? qyWD]Q}A43)բ"g{GtUp>ߑ&2Χ6dح7}hT-ጿa:?_(F6lp;Oc-yv,Y{i3{9=%]]x^OT|r ]xHwanοPrǾE,:RpgI$BӭBrm"~1GחU n0w)}M&J \"8'-:qB?Y)93Q-qpXx%{?dFsqh}kgx ",?MZl*c -y_RN|Z;T}/`>L!<-؂AlpV!l ݒ8J ˜?P㝍Ϸϧow5#xxwo8/eG}6tGJT>M:V⿧sm>IVOt$NppG5Ckds8ڮT@υIj vSMkN` =$93':%/CëEz)t6KHO:H؅ #Y t[063  :rJ½Q9σ'F9 ֦PwQ%X{%ؗpcم4,5>Op S{12".܍pڗ# d)SFǾ@ o==mGq$DA;~JbPq'vM WFg{[iN=w- nd?t+4 ";w/P]A@yCAb?;Rt _a Z+T"ӵO:1bChx趠#:ze|BOȲ2b4 Y^nD+MHf$FV8DH_T<(ڦkOZkEsaDN3Ss'!}ϡmRе)З$$OgۆJΛ|NȦm͟$ģu-rG%s+Ztz AAAAA@o2ڪ2L66Lvԥ)Iȴ ~h#kHlK#ک+]]>lV[D-K֫ MVs6GHmk }4#0ai uOwXDhON =B{νN&dci܏>;@@?>^B8 9JGt 3cύ踃#:ވN#鳓NSHgЭt~ևܫiiiiiiiiiiiiiiiiii_"8" #_*),w% @[79@Jz d;7d 'Bb2_Yk*i&C kHn"%:x dHmy"wC~~"' K_,Sk dy)K@Nqӥ3' kd(AkWE2B9VHV e%h7edVzxS HWƇ#9jH?#9jH?#9j@փ+-iݕC٠K+GA*9lu rPǨ݆#My HVR> aA>.m:iPGGj7d40e a ? AjdڧZ*WtO[5L? r~L(VLT́LG0 ***S/ɤ7&/f/W&b`Qj"HR5J=d! cJ4Eoci7)4n}t*Uz>JS\ﶓ"}5lȤiJRmH fIܚIJi5B:MZe 5m@J=aZ)<ʻ\rZ"ya4mm&2bK<YZXljᓶZi+|R >[BM$G{t&}:-7썠m찬=a\m ;Ca6јLASEϣzg[["x=FP,{yw?Խ?֤e<~T?˵GAMx Jc5FBe@WީoTHoSXh R6^d7[MڪM[;= ;MzWgSwm*7MinRvͯ-t*z{kʆaLSծnfSzlsiֵzw}v:a1[ӢJSOW:5>DN x]9MfϮT4MϪu4M+7MtZjގVZ&+g{U6vWz(zGOSONT:Z:j4>R^nvͫT[f-U)fG}vv[{[zh9т0:Z{[i5Ņw/l][:o͛Ia֠]A'ymhtTUJFDUv5)Z43MVmBcIL:tY%?IRt}1 Mp±Ϣ?|g  ѿ7ǥc'(o|> ALtpwH>t) ,g;ݨg}9?64Q̖ah~j|2Ժ7\ep@%=g[mXW77KbF̉]#bOC%@r9B%Hr9CBǑ Dr9BNxr:9 lr9r!n.!8Wr2\K#דȍ&r3Jn#;ȝ.r7{}~(y#%nϾ!ߒQD~3Wȟ/7Ynsgr)n7--- Fpqs+p+r#UU&n5nun&67[[[[Í699s4\srqsprqsȕ8+s>%7ۊM&r6n*7mfrs;p;r;q;sprnµrUn67kjn\upu۝⺹-r{r{q{sprqsprqsprqsGpGrGqGsprqs'p'r'q'sprqsgpgrgqgsprqsprqsprqsWpWrWqWsprqs7p7r7q7sprqswpwrwqwsprqsprqsprqsOpOrOqOsprqs/p/r/q/sprqsoporoqosprqsprqsprqs_p_r_q_sprqs?p__߸߹??\Oxyy\˼«|KKe<~9~y~~E~$2 *įƯΏ$kkuu1X~xwxO>~A!aQ1q I)iY9yE%eU5u M-m]=}C#cS3s K+k[;{G'gW7w"G'gW7wO/oq'xIDIdITItɐL)% JäeҲi9iyiiEi$&.֐֖֔֒FKHJIKcRdIH2RVIyiCi#iciiSi3is IeɗI[I Di4YF"MIӥmvLi{iiGi'igiiW"͒ZV*͖HmRMM+K.uJK]R#JBiOi/ioii_i?i@ `P0pH(hX8xD$dT4t L,l\<|B"bR2r J*jZ:zF&fV6vN.n^>~A!aQ1q I)iY9yE%eU5u M-m]=}C#cS3s K+k[;{iX꓉ɼ,Ȣ,ɲȪɺlȦCaR2pyYy>>>>>>>>>>>>>>>~~~~~~~~~~~~~~~~.RTRVQUSWPTRV}8M$MM4M Rm6L[J[Z[F-ЖӖVVFj+i+khjMj(m mMm-mmm6Fm5kfkji-e6666666 ZQ+iV|m mKm6^mM&im)Tm6]VmԶvvvvvv*,Ekժlm֦մݴZ6OZ֥uk=Z6_[-׎ЎԎҎ֎юՎӎNNNNNNNN........׮ЮԮҮ֮ѮծӮnnnnnnnnמОԞҞ֞ў՞Ӟ^^^^^^^^>>>>>>>>׾оԾҾ־ѾվӾ~i?j?i?khjikhjik>..늮ꚮn)}>T///חG++#UU&}5}u}>Z_G_W_O__7ЛuKuGwѳzNtO/뾾>NJOз'6}>Moзg;;;;}ޢU}>Gokn\]wuS]һW/{{{GGGG''''ggggWWWW7777wwwwOOOO////oooo____?__??zA  ɐ P 01j 3261#J*ƪF1XXXXmckgo1͆e؆cFY#g MM͍͌Q4Jg gle7&[Idcc1՘fL75f3]]1h1Z1ۘc5c7cn3:intFk7{ =}}CCÌÍ##ccSSӌӍ33ss KKˌˍ++kk[[یۍ;;{{GGnjǍ''ggWW׌׍77wwOOόύ//ooEƏO/ƯoƟ_b$&g`dʦbfafb5KK˘er Hs%sessU\\eaiem61537ǘc f2m1]3mf̬3F&ff,%3˦onani32Ṷ͉̈̀$s9ŜjN3ۚ3̙N.fŜef՜m1̚9l7f4w7n5 =̅^>~A!aQ1q I)iY9yE%eU5u M-m]=}C#cS3s K+k[;{G'gW7w"G'gW7wO/osٗ").ŧRrJI)-JJ-Z&55!ujbjRjrjԔԴԶR3SۧvHIk 5K6OvsF:kbF6ۖ>Siivȭ-]JV_nwUyVT.ίʕ)zGuRTyaJHTV#6S#6!l8"qG&F:B1;ۓ!yJBWĦDuElj2sZK}޼JT{ Ӣ=!w:HȽr3dI{&EHڪ=ar[MwUj{OEixݵ9*BOWl Ajת{WRGwogV;4;U_^ݣRofG0I=mv4׻zڂ~ejx[_ivTzow5ED{}NQуs*=8'hfpq s6iGt<^:^/8x܏xg~g~g~wjUh\B#ՃpOw[*ֹ!f騩GRIV.[;">[nuWZY@B\_*!ϮΣCC Hݝ\li%U+VWh5vcT02nFGUl OG8W-հ9- [@l4[ՎJa^jqԦwFK'lK"*e]\a5dzj"[0s-SIDs V aƖL>mJFzjU2eZCYEeE{r-VLxXM)d.tvV1oVkߺoWSO SpVU,j9AqXWVWWoxWHqM( lqϠA'0EinX5:Er ]mu94 C[h(Ճ2ٖnٶeۺu;f w]4x< σ%2p-Zk\ p-Z'#`|1DN$'DJ'R&KJ0J0J0J0J0N0yn%J湕s+V2ϭd[<4!ÿÿ8E2d^[ˑ1ςSmʬjK}ެ(6rR[i{31B2ȝ}Z;=mVgA=)V**H6 [(uL9rgf6jIp$}tϪoU>}1>;c|vq"`1^J,EJLrIW2O6dR]Ի--epP4Eх[zg6vA-(d+xm|9x@,x@ + + Głłł-_ |-pׂłłŊ=,kᶯUP?pm_ }K/K/-hFƾ(҂)-hJ ҂)-hJ ҂)-hJ@cZe-` -p H W ->}}pHn;.x<ρ%p jUl|`_5ظ}n[Ys*S7@ _m|`7ظk5w 6k]l|`5v#0l|`;9w6s񝃍lõq=\;?Gy=l|`;N\6ڸk㞯{6ڸk㞯{6ڸk㞯{vg>nYr~Yg~YgbceXYl,6V+bceXYl,6V;AcXil46V+JccXil46V+. +cc山Xyl<6V+ccỷXyl<6V+cc山Xyl<6V㡾Xyl<6V+cc山Xal06V46Nil8qJc) ) ߆ocŲaXlP6V(+ ecBXlP6V(+ eC(6s <!ig¹p=%ېwv ϳ \C͛Mk;אwn s a6oY!|CKx;nL LC853 y-)mlٲ gʖm/ې_ll\C޹sKHky y7_lqd+gنp!m+p!ml컍XKzk5kx?P\C~ y7_lqs 3 lC85YB86s a6olC%<6s a6o6mc=m| ʖo([wp!mq2Kgنp!;m;نp!ͦ5k;07XpSuCuCuCuCu"x /Gv|o{{QQQQQQQk:ؗ:؏:؏:؏:؏:؏:؏:؏:ww𝽃|g;{;ww𝽃|;{;ww𝽃|g;{;wsu𝫃\ssssssssssssssssccS88#p8_ gQ?Sn πgsyx[o| -[o| -o |6mo |6m;w|;w|w |.]w |.]ু~iু~iু~iু~ig~g~g~g~g~Yg~Yg~Yg~Y_____Qy灟~yG|+ʇ|+ʇ|+o/{e~>}C_W>}C?O>C?O>}CG>}CG>}CG>ox}CG>}CG>}CG>}CG>}CG>}C?>C?>}C7>}C7>=C8_ć>O|ć>O|ć>O|ć>O|ć>O|ć>O|ć>O|ć>s/rƇo|Ƈo\B7>}C7>}C7>}&< / / / /"/"p-"p-"p-pK-pK-pK-p=z<x|8>p|YѸ`[\8<Oq|'Q}>jsV6^~.֎BV >8666666666666a6. E0>}㖬>qp9kH!9kHo9͇tƐcȃ1` y0<C!9'^/=2x4H=C!Ɛcȃ1yy`y0<G#Ƒ̓X`,y0<K%ƒcɃX`,y0<K%ƒcɃX`,y0<K%ƒcɃX`,y0<K%&X`,y0<K%77ƓɃx`(VX|33jX6q~5_ )Ebd׉mt>{rR6r* J]]X4G]B9~~fPuXlm'PTuԋob <ۉci <'x6v|wpS7O?X8~؏/N Oz4<p1Q ʑA92(GKS&]{ g1DzǣǣE*+R.y*G䇣䇣Fg(%g-t^>''eKIqc'?E$I$7璘qq+νe/&1qޥ$&;_1OD9ODQ)νĤ)HqILRb'ig31I$Zy$q;I1󲙤nC3 MJsl&)>V:.}C2rQ4U{8t\YmkK׏ݟ&.}R~)>>7٤٤ٸXgl&Kٸɸ%e%eŋ/ox*{~{~/Ϡ1bXMښ#46I$M&Ic{}Niҍҍҍҍ "Yϲd v3 ` Mx'VΥK]:^;=u{8:uPs 1Sl6s~٣7r["LU풋V &\u53$g+DŽ pmUw+{~@^O"^#E`#Q2}ohU/^rD4no~v%`pO%5{<FϏ(k`-+;ۂз-(=[Y4]@{?ç7/U3Y|:m'$93O%SsVƚ?)㗟2,s`_`vq6eI{,'ǰ_ioe`mLÎf`ϱ,= {.aq6c 0&4c 0&Ќ S0 `4FP-QЌ90r`4#F9ȁ#f8`8`8`8hF )0R#F fH K3,0,0,0,Ͱ4#F 1͈#FL3bza *`j*``/+ʊ (+ (+Sz084l. .U)fx`x`xQF f(Q%=q0[Zg5Ne asfk|e4f]ў)&/2Mn+N`ž."ڻ5M}SȥȺj7=U;_{v|j-vޠϣ8_prX{üyq~lǸc\1{z n327=*,սg?,]b,I?-`20aB >l&`ݰm0K` Qg7sXӽ ~w P 8Ϻ].9/>C ?ky{uYkcc`bY$ƼHaG_@b^*axqpp C{uZ&}ھvx?۟~1Yoݟ_MaT.FŚ 4z*La67"u+@X4,IVaq]#n7.Uߠj p c]1Wk11ʅ.iye;-ݱ!!:}nH:{-$N!aȀebDӲӲ1s(0}ˣ:G `ēy3-ka*,*|Q򊝇7)ש:o!9^-~#ױ0W4vj,r שvU\5 \y/DYv|zBlklbЋM_Ìĸ35TUM ǙjDqUMqb(Йeաe*hs۶޼*٤66OiÿG~)jQLL26v݉D"HU(Zfln:aLtK S/Ֆ"\=*LtO\ q߫z~*Um623*lH™&g3x)YԢ Ŝs&JLV8Rv%$ICQp`'ITuDX+4kxG endstream endobj 579 0 obj << /Length 795 /Filter /FlateDecode >> stream x]n@F~ 07dYA}R& }QZR2Gw/K1SXep}}^e".(ݴٮ'%\ȕt;/8|ɶ!̗-{9a\.c1MrgC6:k7}a]Nc \` >u}-l9dv6a[/^n<!P UrPy HC2JHAxx)*@5TB,)O5%ֲ"TrB6ħ§]EkuZ5]K2h2H2h2H2h2H\k\K\k\K4(qqЙBϠ3) z ) u3Cg // /&yAC j44iРACK+ɧWO$&_I>M|D%4Ji$$*I<}?J-C5T@ $  ib2+P Er[2BB%!SvO<{VPBXSfJPЫЫZ(^[YH$D53k<سdM,{l$bf̦(4qgN;,ېeC#61bM:i"f"LL lqIqI #ÙA\fOQJ3qpqq3n23Lp{x(Ԩ{ 9(yuiIF&k[s);_侌bMϳi endstream endobj 580 0 obj << /Filter /FlateDecode /Length 1041 >> stream xXˎ,' W4yI#~.R/"EY%fEs{*1?MN?JUyү׿Vr.w/"¯o$A^.,Ǜ|푊zUAaW5, @u4(hi>*cTpɯuZۨ,+T&OJQE:i$e]e[F cg л7/ؽ C![ Ft¿-0{kF!NSf".L͓Ơߵ);J9`^hčH<{LKxw&n3F?ϰϰTUIX6gqc@PM҅Y s@x*! O/EUV_d~K^}>YwYg] ӓ쪺NO'~<rEj_j#U)ci띭ʮ".dRdKa;fөz(m}tun4`f%i#N˘bq`t~I 8ukP2L5&E> /XObject << /X1 3 0 R >> >> /Contents 2 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 2 0 obj << /Filter /FlateDecode /Length 150 >> stream x; A > I b!ja0 VV" gtpIH)P`ޣ0q|h"YW8٬Ϙ0&KPq*(: 93|`]V/6R5m5|:gHtR\"Ϲԣ_S endstream endobj 3 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 451 /Height 631 /ColorSpace [ /Indexed /DeviceRGB 255 4 0 R ] /Filter /FlateDecode /Length 68927 >> stream x}'~fFCp@H 3hI`][6PWyTl^Ȃ­IXQ*Xn6ijf6rgyDM9g3 KVVG0o/ڋh/5E{NPE{.q!|w=b/ | 羽o/ | 羽o/ | 羽o/ | 羽o/ | /נ=ǁE^gb|#@(un9=g . px7}^l}ớ@/Wā>}{s^@ܷ>}{sWsW/C,| E/WWsW/Cba_H}{L]Ͼ=T{qۙm6]5owe|D864"F`{ M[wۼö\T I[!%J#[>}>!_E*mh([ǏDbֶM ވ@elt&$8=44<Xv%HŨ%)i3|\B?Dh~L#<@@Pz݊8Bu;~Kp7Ʒ9_v]Xxa|kR5'&CYcP ]毝 OX.Te8*Şܿ! ǨxTW|W 1Wƾ&K0F˟n V.ێEȳ$a9l83Z"<|/"q#3p|?[1"h~}o E" Ȧ$QgdIBr 4_|.j"|L;#q.Y;p@|$i~%Fbo.%?X8dpWG}(Gk^†bл-a22fsR|dD^_ i/*/Qp"Y#?  ,Fs LGy(—PC"&^ 6 wR@qriOlkx> P[K@@oTH`/W )ن+po{At Hb k}/\pC @'y2һq)*{}cQ~~]Q]|}8g$brCHWU/˃#S$]T 9 ?]I EO3gvn<BWaDLS[!I<[c`w05g5Q SCMʤ7oڅRy<>0̻e"/Y)<Xg [!h :ϐB;to7JZ$Hpm֘( q鮮ˌ @ӄPBje=kd<ûį(,Bx px  o!1gqduB%!/O_M Jb„@0~ בۏ_mԋw~ )dqWo(J~# aP2iarDΰ!xkI"? <@Z]| Mt!D1,S!!8vtp!pBT'J}Y1]@opܡ0۸ B)}=#Ė*\`~"Eb°2 !RO!N;Å~ (]eav& %2asseby R a8K$P DqGGĎW LF1b/3L1_yo!v0c!^ Q. w! macc($X_PWlvʒfTDFB91 @HOES -Rp?ƹҡH3!p$t?97 eN8B<$Hxo_3J_#&:m,GkBRbބ; { ˒䚖J3aa,=ԷٕسЧo=/_F{+99R[Ԥ$@{wwuT+^HKfzB}k_kO}=<6|S4|3/ړh g^=&/ =;_$Ok/ |M~B>&?c/XPw^8_&?΋. =J{Wԣ?(<lO2HVcSXjֲR,aAָȾSeawG77op%.{ޠ޽Wo`$=7@~,d-K= Ѡ|\sw$ pWs\\r ;+B9 /i7 y E&CKBA̻/җny=f1iw'wmz8''Fo>@ӹT=ifp_77I'O+eղ0ccBT!zb؃="HBs[d&sYAÌn-Ӟ_v XfH=$@ !Zu(Vr=1 D \eCBz^l DDjeM7a,!L~,|B)]@qjYBPU&>~fpTr QYEa|?r{,E_Bܽ %4zSaʐka:R|OBVY.>)^D+@?JdeǶf 5G=Jg\%^5{߾*]ònaEAVJiZOH1Q|iXnY !uRg"HC F`F!=ǂ aC~A{tR㴮Wr }#Bil Tet^r4C!\eEE2#HCc!0pt8<3m( lq6fH/cQY@(#C%u\ W@h:Eԉl`dTd7i GpgA >vY(\][i=U Gb*UJ%G/rzWXWON98XJ5*d wB@g,Ψ`ǨjD)1`˅lT4>,[ Ґ+3{b44 vt9=WAJ֏iݶl 4ZdhDl l$4nlsFΆ ΁w⌜1'ڴU4&) vxOнJ^ {Δ7\kߐ ^@p$+ejTW2)>ZЇ0&입L>Sg, S|nffUQ0NV#LvQhQ[Sm<ذjM!_Ө\w:6mV powRx$UpHLV[Gį"5B0m;۫@3/Cϝ:>2Հa.AVE)0q6,6A/rT)0$g8d1usȳ;`h |p|NT4br5dT% R"ͥSIbdt/pQ, ;yܷ$2\q  1 !ajOV w WdтȁH9G6̋/v jf{ ǂ/X4&4d'n[H\{,`clG} M;T&9KԔ ϥ},7A |ۤ<s"2AFTc5nr/)U@OP媳pb'J5r9 s ߝNqR:^7v'<1F 5+@Ԓ`aE3R`CT%UMAȶw :A]8ċ5i\gN @S0*br#[yuqrr:rU x6 z *x8$UۚDkfPpaі-gA"h9Gꜵ-Hhhja=rUhhEc1RH0$2䟯i(B951ZQK%E)]7oVW ow*kSЮG{@0<Hg[8΃mOr`$"Nggٓ=uu`ɶidXoYVo#],K&g@IJzqϝkm(%ERLLX풅Z}i-ؘ"^J BM8Ep^}#o 9*: .F -|@MpA O1/' &Hm w 0L0ya=/B*Rg+~UuSU-CC]Xz-Ri( H)U'JI.p:y7mOE ,pv t@C:+SF5pLa1d˙v3%WT85lCT Ųߑ6/:mS*Hj N%iZ!²KAUt iNM/zqXL.fM?㖕{d#IcjKo$p r98$ΩZejKX5D0RJƁQsb`Rv! .rt U%bt$, RA2= m7"~cW)͌rƭK>wfdUx)3*7YU2Tt3K: N(XA<# hlԣe{0q? q2 ʈ8,3­]{_x[A Rc馋_'J‰iXX9'/Aq6\* H8l p$]wZ"R1%sitr,w#u=*pjr;fvX(a@î8N 1ºbȐLeï^*ݬ^chBLN5ޱ)#@  ,N`8dȃ]+ժ)ILfdutk4Ĝaa+dRxK7 =nv's־R|$<aE- Z*?GzVԻ B7KfR2TK4X&mq?]r'Nj V)aL 5k5 ۠89KQW*Z KP3Hj`$I*?k~̡-css Jwnߢk :Zx<l#LB(vBAB!$, 1K!2QfRp)7 ^Rǫ'䜨kg~D͙0 cINIu)CN]E$Lfcj/A޳ .aGbMm1̹jyD}R3~N^phDg0[7 LO+67D6mhsk3trJ4@ J xSA Ϗ0<$HH S/zJ~v L{B) 2A0 n #RR"'L[LQ%_zuÀyC^)y m{*ʙ1 1g. eR3$4 V៤!z c{Bt9&wmqsL\T4ܐ[uO\Z|@:7A9]SaO+BLj|anw"('rbrx<mL'.[AsEJOH_FuRz6uuV6Y< ԎlR o&PǕr3,b` OS,9|?U0S![[,^cKǿ JIr:C/Y򿙟;CXqf $Z:  K FӴTf-9$g\BX.dqmQ@^ ~}[)PPfbǤ:˽ΜI@9*l$[}E:`Oة EEKtp9Դ:cX73!LCE8yh(=gm0IɅ !a:-&'H}R2DeKZV]!) mZl$b<95s~Ο49G0_'1ko[Ij΀艼ecOb[>s$1>'QpNJ M/\ l'Kw-)< H}6} cX i&H\#Q= ,TV70ud}@GFa}v1}$2vv!Us}:!WqPE¯yS53soզLpkE,͓Gpv,vV#oR`۶0X3Zs)QՔuUr.^*%Y6e-'qBE@aXe9f*v+YaJF/.n ! Hj8[blqG7kߪ"Ȣ}K\=iwdNp\VbwFHѦAn+/d}8 M8 0Yqƅ:,ikoXq,ViGf&]u>RN8>MH ~e8Z{TsZSJVANɖiլ'{G.8`3wOS ĺd/t() u,l`ˡFϺpmaṉӼ Cp7)U3ô 33^S54NIZD)n= vf(M(Yb)y@V }j:r#_䑒xAΡ&O\&J.XVRN,'lB?4H8)Q5 z~(! &aX0.#kgvGÇR<4Ny)*v.|J$b/7Iť]KPf(]T&IG0idNř1ۿ\7ѯ8R'SPՏܑ\zL:irh GN9_Bw|i$)BM#{QF8Kھ^!,nEX$0 D n]pN;k5֞ZLVu"_>%'Dkl0><%-Pd̟$ *$@8y^Sc|^RJΦ95g/L& /BdY8gB+IRbd3z. O8sj!Xe[18moNÏPٴ 2+p}?zFO8l_"91Tz)IC;Ql!Dn%8, wz#j<,A_flXط~qЅn%/삅OBP%itrphxɌz3!)XTFH!)ۨ]yd_29jd@Jl'%#u@9AS]NpYC8C+ɭQhOFHM."!AZh8>F5CǢ1z!ˏ E>P 9'>M x`l ,sĔ4`֍T(&,K] ~oig,s7Pn?fIIM4I l*ǎ?yy23W~`z`ldAMhj\S2Z23ҼFG":888: ãu ãBHˏV6ˏ#p)6xaahtNbN[Fè #bH 5r9k9+۳&g˳3 \ڈ:Tr''-el 35Acm͛H[4NIQ'r$r՚r*у %AFT27 φ {ҭDb'n&~8%ARZI't4sRՆh44 'e٬M %|K6̊q~,E_.._EIcΞX}XBאCOv~Ї7EJI,u̔Hۧ v.R:q)(2sF+9erOYTa>~ ,U2I9ɒ9CT9%Đ.Q9)>l;T 2%O+j(GN͢M8dV<6dpT;y )ZJEJbdo;i8ѣS'Ns./5ITQ湴 %pj4lת5YFIG2dʒ&ǒA:-. d]Hb&=9[¯B&M׿?u*>;߳uۓd IW5~Iނ]Njr(Ue#]מ >Էhs4g(wݣf|,49lT/2g.9~THSL٪]Z[zwݵR)RGVAYMp& R2m?-$0Ћ{ rV Ld-Rujɸ<\KC JЂ2Mѵd+&ǝxTW?Od9#p3>9 PjhXc 3Lwַ=XcFFT1K87S1q3L HOs+gé0b MkO36 iS[Vwl̇0,/.X)#=| OV. p x)--iNcA[+SVM>MdL]MD R8+gc5. ygQ ]z̄+H1lak0\ 2hrigJ":"x&i櫇{ʵC]o$HBB'|6ޕ֮eEF(IXh{@e-X)MϿDznKB(&HνQ5Z2a@ΰNF2*',IOHd !f6+U?+L1:dRu,Yz *,p7 l$؆$D,aӛV]҇\:",rӺyZz4 3ICpgrm2jNoQsƱGM"7ӎpzVB(42L=zB%%ju' b(iWl!Y !/tkJ,pNlp,=FO4PK!UGKj\ -ScJ_@1q<i!'F >A` ,RflbSQd 'b5ЀtXiC(6L0y6$i+iBphjyLch7)o9 tCmuT^CYl-JZ1]1Bc^yԩz68NN04?L$H)W ay~Z,UƖ3U+2Ӆx/(}XB}3sj]wuAurxT[攄.|@9M/.ȑxtAɞAGDPєycqAR+~~!r‚6L#hNẵX !aآ$t`XU=mT-@v !jwy Ku?,2 . vӬ귂c`Y5GxPiu" QssJ$tiT t5:p \q!}hBO¾dE{d<ݻWą%Ӳc8Xˋ90[Pa:1эeTÇ7KoHJr,QwH2soÇ.> &ϗ߳͏6Wo6:a ȡ,+kH\B'27(nfX59_y%dg¯<p+ܜa *-l1اͷ=0o(9`T,6G@! a!f*L`#Wq$@wB]RQҳ`TfӒS~!]=?aO7椶c;#6#Bc9ߘfD׹s>%Bd 0?ؤURA[,\~n0o"J9)Il^B^ysLAgM gB"G3UjF\*t^,.OW})C|DÇL6u8)|7H )s^ uz2iӳfԕw*=|}!|8cͺ+rUú_0&"뉤D*ѕO n zd*'Ls\J!$ Ų !H,I«ЄJ7n:Ettvf )BtUaa^Fӹ9[_lAw} Tj۳q1gs y^t6FFCiG*_q Nw ۇ;B~|,RNMslShY8 j>"+pmj RNpbsy7B cp4+M {b 2vl+ɿX=GJ F $]d\NKaPg]سW l쾂 ^V-B$HC[,L&9O=fqLشKK\8ރ"8K^&6=wO%q>F,pϐo” [l$WXXVq 2_xB-dAhg- W.6UZ7 6`9Q-RLq1Ms~t]cFpp,lW,og^y啿zQM8T2-T{=6byp8U:L&:J+'PZ$gB\?,taU5!a1,/mB "Ȳ'5MBW} q9 ~4-t*Okj8;+\xb:!:q6}WzծoAdai]Eܜ<7Sxl(=f?;<̞[3xJ4IFW," kHC*@W [̩ ki7` Rs`{ZhX&g*jXʧV+p*( _JҪw.e_s q E?37q8S4klmR;UF B6Ye,$Qd M#xi€( Mւ/ b/ պ{AY5iM/W[u {Wb ߷UWNp}XwLJXbr;37 n)p@zP,`c>x]g21}:U#6%`5j !٦ШS*\™ Pp̳HW{lxo~WjPd_.̻HSE(Wh-/hXlE@9PVHJQLVs#ſJͅAn;KotKu'c,ZZ^/\-PY5aW'naM]5\.G!L+GaP 5iJ z[ATܭ U<e~y49d["vDnϩ Y]i?jUN߱Z3Mn)O o]Mp(L2ZZ"vyGaIMڙU'i (HDS&3g@zRv!tfmڝ 'X"Pg)( b魽B `sa9yVɚ?9~Y4o |7d9wsyJLHjVgu9geQ`Ol:v|jN]Ǖ_¤;INHBB.߾YnUx3۲p ̶b k YAP OV4Z j1bYD yJ< T'Ͽ2몉cMxkU5"bļx1ֹlJXj”ҺgsEp(t!'%VL *,0/U!!^RՄ[iİ.$ fFJ*^_{ǰH{3Иdž(&퓱 $Yb g=i[dn^lM:j7j~'ت6湐)dqLOpJf*99t=3R$Kp3IǓӰy8C6{h jLVmB&$bɜQ$"a^2[H3ڱG_ /t(l*ΠmkA*#~AI-Gy2O]u|e ǯp.$κ5VI]LՖh0?`ͅyPwLzb- A=y\x,Hq4gpn!+gpBo 4WNJ F͑BY˗ R֓Oա.D~6`+V=AbXnk&UK(\n|M{k6NmCXyYZoVhtruVyVa)[aZ"lHT^)XX똤78 59`)Zek8\(p%>@'ߙ_`2"J.D_:bBQ}M-`UՅ~#,W\IzEj8(Cd"VѸ> ށ7ꖊ(ZʱM6l39'iTI7099$2<. P)JnV aЃCZu6n$ gne!mX-:+)Wn=E&s%jYou)fZe a'o\A*͜k&8˵H?Ӝ~nN:Id  -Peft WlpY8eU>ԓZ4 M,ܬ n͂2]mtŇ+ܭ?~+.?"P NCaS3І!Q9  ќbÐMnbվ22/S)AN޸5i< BӸ+i+A/Pۚ$GpBBnw.!xl*Aѧ0isR0}D)X۝+EEnymUͺ^*U]jEѹlRKW-,50f+l+En#݀' Jn50Isoڔ%r2;3۰,|@xM-@4esa2kx !\i5G\{ 6M\ H=8He4AN)x"7nx؈#Hӡ|,.&1cl%'ᣳջ4!l LI_Y`sRU8)OU9\XBȌB @Eᅥq!_#]"]ԇD@u5 R[f7 ܤAy @=G $TP#VyZ,AMq 粰dMp򞫎JV+Q> GzkBDp`܋ek?pwG5? 06p9N?ztKgU6V;ͅj?&j=,릎.I:|*y]re*a;#vue{rsYnt3z,³nA"3{}jӟGkx<{r\ĮWNB3,!dgA6/Uv[̜oY8m4S,9b~k{c-YcGZLqj[\H v،B0I\()0Z%:C  Ql >o a#Ƌ1kaߩx (Q&EjȗS~t[OwؼM' N"ԧ2,JVV]=Ɋ/{ʪB):/eLP `&WG/ugf[@_G8DHnw_}3Ii\w[¨ZXRͩTVTl 5Ng"ypBOEl~Y2‚!dҒ35 Qa#UܕgB2x8,h0"b8; n0CAtYhӹ`7_{ѱ@&:Buّ 5"1[`gRG<B~P4{ΤFR/ys5wj5Jv0MXe^#t'&DT4-ByE)ўDFFJ|0Ddw[.ڳ}pXO_ܘaI{e~Jgjg򎙔43[X4AQrC d[Tض^=G,C!Sóz!!7'W kOŧKO4 ?<7ٮOj~h>}6`KX;y#ՅNRv.85TGSURЩ@J 1%П|+)`txY"![_s#%p= Z|1r|^0J}5+)eUGf4/Tp3,:hn9h-0cMXI-O6`n@(kdBRPY:}p\]ݣ!>-bvG4ݯp5riϧi<8-Rrj%t6p1{xQtp!1Ɍ)<8lGk˙"- @koć*N7V$8" t\g({ ѰCB*Q# t8> Wp9{sMKcfAZ%2a3q|s6TI7q>0URynt&?!Ld`"~(\*VCaڛj^ f#3\_xO­Yh& ^^7tZRs\|xg/iΟjh Z +xX2DV*@gs[s1GX)pMB "BhJ(ûi(p a[q 48gi*klK$1p6!(CM75tKqč\rg}MbD:օеlOz­KrF=gխL2%ѡ[GJ6UC8r^7zUQ4s%ez6jvtAf<z>͖'/򦮖UІC. gjPJ4fUp2RUnҧ Co.-NKYEQց. m&_u bjsq|hb;qć:W3%঎56xn֪lf;o}Y-6WW''KE{JB Е-8Y"4~ulWrBZoQ|=XXy` dAIU|a~HOe~́yu,h\mZ:Hm*Xd_0~Cr;UAj.Ja=[$֑rl BЅNV^ʚB襰 X;9 I0Džk)* -BQrѤٯsb\A#VybܜYh0: ^odHαA7 ($ؘ6 NAh{9:F՘9pZrSqZ I$f4䧧ThuF V4[R$ Z* ?SsS-AҦ #Ks+\ƴ%)BV_^>qX+Uw]5UUWh:=jģƓ9,ꦞʃejI'sP7 .@9kƨYCH- H%HMDkx4Yr1,gYGdKV.p4:ڦ,`+D¯ I4cbS͌KHI7xwf.^7yJCOK;]Ej8;MO®'YDSo|_^ZM RΨUic57!hmNs!Ӛ HC!R>C! SBx@x]-:05,$5zc'9C[dpJ)5DQЃc [j UUjs Cd6)Z߼p``6 tj4v7 !Y>4งiM"mf*HQbFc.lPBXt|q~Ϫ1$GK @\PS8rhe :*rzX2lsgHM;y֧#zĉp.%Ӥ KȈC̛uR3,I#ȓ#knh{E&.qX/X2SZ7fٙiJCЅGҊR a'ž/xp&x^If4mdT ^))z0vzKɡ; 2 05FSYLږͦ!˔(D'qLb, K{St!,;T&X 8%:$dY;ړiNUޗ%#I% NLB&"iEpUaI+l`0r'YxV}"5%g4oZWbz>f#Z&}(H<5 *HwUɀߩ(.R=|D=xkJgnn=A-NasEc)"܅,~ HB]W&,qB`ݟ~ϰWAF3[ 5IjčRS\:>85O2Ed VcR ƭ8sŨq'n &-a ]Dp/jd=xzҦ786^-NG*6e2qIaZAAH'xif"V^}_>挎ȽK[OMl0@M\4e&Rt翇ڰvL7, ;iY"ui!kRin5gZ`Xiշ[d3)Ij)<`#hP](=,BT8E) 4$Yk.<,d$\( I35#dOnJ\%́=4ƹre*g|VQǎ}2~_ݞo=><էjXnX &׶ҧR2)S,+XBSbS+@cY+t$FZ9kER:\#,لMMFhk1X\UPqC'RTMLiIu.qyϗfjE"09Bxu8bŽ['CrK?R`g9njUD mbBG5&|w $dX+b jأC[5aa./Ed1)r\^KQ;,3kWV:ϣqE P&pX95Y@=P|"US%qoPP#xU o縺6< UfL\06C)tqN1&[*]R!k!m5D' :u(y B1j`SẟDg&?Qd]x|1A<t3L2* Z$ cnY;l 'U&pӨ߾XZ+aް2x c,3b*P.̬!-5ED D򊬀F=NBP;(Bqia F# <^\00cFҸcykQngV02ӵHg"ln2]p6fΉy5k$ޭR5C =Lssh0U1IBl\КdS(RJf&AEAvQB\Ak`2х^p :RԖr9 6| t|&"NmbH k&DJ5|RhÇugiB3{-ԃi"E%\k]LuibyڥզUnssnKkBs݋gU6ͭ4 XHiMSw } Ďk^ I"HC5*sMQBz{m³7g4B,+.T9>[Kラ$-wXmHх"'$4"D9t9ĉsςo`)9-#7ٞHY p[CbD6wZP@-|bt;.sr؃ KvR) KKҢuVcp+p7K^vȤ%uגZZm\ v' 6s00 Ic,Q!wTn:g !)my)c0{(ٺa1J»׬!98*8+p*?lV5 NRuM,Շv5CdÛ(L&w驹zi؍e/(<{A–㤍ԇd7QJrEc~igvI"}4v-iuaAEc| ǬcӱYdOH'd%h T-b^Ez"9LC6;} lk~ &Mt؃A'w^-c3"eҲe&H]}(SӓuD2ӝ+F1eįS3{!,t _-$rr !ؼԬ=ߘg1Qw!BS j.e8Ǡ4EU5vփ>݁ڬv& %KE%-2Tk9-y훟'ఛjR6.&@FꍨL+4Q8Sa0oz!9"{e\2ac V 1Iez5~E]Յd-4XK__TY[e[igU[=!p|5WhzڪOΐ:BNujA/ &Dhu@-B/ID)D&t0 = œA3qa#C97ęn3?Yk- VWrJfdd3y"-="{X&9JkiD%ڸa\Fip[ . Ow ڥ@-gIa~,~datU~s;~{KKIT _pp~`^r g{Q=tm׶0Z)%NMN."6˒(_S9#_<oY/m^8>`9A ڪVi+9f7P'.!}j8X6/"?, nuZ:[Ƥ= 1%3) UfB.i"tj/gY R4UVim y ₣W+ǑM?:|dKtCw~QZ݋$|tes-V.0MD"40_EH$ԅ;=j9Ã]> ,!t>2ˋX&V.HU\1o‚jsU0hHgb|ITi@.02):wG\ӺƱ&%E_O/ 9u'O*P`Ȅ7A88BT}g*H5q vaeXK$\p/O0&ACv*:;VuU:aiG,<]{6}+DАd-!^˵Qj]b|SgJ%Q"m<ϧA:a<3f]PUI4nqsr kiVBX0ƂT5-.֝C"͢E 4>?6f^1"H p IWDg+HTOi&=Uƌ<0chnEQiޕ%R.ցIQ@˷yc ASOJuߐ nvtS+E7AHJ,d @q#|] xdDO{IQ~Յ0(P=>Msko5I @I04a'c/*DdJ9U]"8iUXWGMjJVP'~G`s96< Cӆ5 'QaX4ՙaͱ4CF## ǘ Ǥ%\0EH+X$WG"`}r8Qp(P Rm|wǏsRe]ɫ"Ŋ RcFp/@"_,[]S8,*/yf}dLt#G gإ8LoH ffh`'_mcQ҆@JtݐxAD4Fa8?66{%4DÆ $}&}r=Yd~&2u4$ KiC4g `rĂ ]jMqB Yدv  X"}Stݠ3z m뫭yTr]r'^8Vsɵ#?O\[Vk*dolPX?,)O=GZ,H0ٜ%u⚌bL%O*&äl# _1}5[Bȥ yiENBѶs soiʷj:|JT1pBxW3ش.bqZS@ `E䲉i`V'KYwȎ33!D\Ԩ"H[$NJ<&V5LX|kQ0iq8ͭ.SUӯA૵3ǎU<N48{du}>= כ (`h~jRQ BLQLo,')tث2dfAQB, ܻd*V\- ʉk*ط*ꔗ>ڽ( xBo+Yi\g6SM^q r\C*7qEA(~a?~;|&?)sDT(>W [?ͣ+d!6 Uw럆- QsU b B?4!o1=SAj.Bx;K-*ZƮ jwk>zN׈,N5_o. HЫ7JZհq$yQ7ߐPڶXdcvJЋ #UK{NUOƱK-/IFzߘAY`Cl >]*]Ahp1r?^㫶,|ڥ=K8qO Zp3u>Df?(X5Q/Wl n ҧT\ 9 n/B rKXZTs3*edJVB[֧>6>3A¼a[m}ֵK?"ǎ \~Ӳ#«K z_n!1^N6eV~ |,,$#xN948ǘ{n];K/Ut ,Sb@Dڦ)f.U SR6R+i=wY(p$K@ƾȫZsdv!*c*|v OO{(2 =L/\}%V!P_JVZL:-r s!_C^t- !PUpr5R;FZ[`X n ċ|zS7e*EԂ;ACB/Ί317>Ap ݞxHi/"]װFbnRXגX >7W! 4=Y\^BdA*:e mX%zJpR{:.\ngSn"Go{!/3܍?W& U~8nQn?xpppttp0>zÃã^68<02)8N7]>62/@'WD"[# uBbH 33bnTMي;:[x<ŹPMh41JfQ͒[xGXY8M>AktbJD|wPgUsU7l+շvDn{,x UqT2R ,E[n{jÞUjH%4U=iAb`|>ӒY/^uvS mwAh:Ca3WK<ٚt/ ӂPS.ɲ8SFPR\  tѐx6ۗ.W B: M:/ ܞ..FЏ+B|SrYq!kO  0BvKϟ?_V < _fs*grLrڍ.`8iy4q|Kh\9S՜o`+Ԟ|s  BC`Vi$`[:5&^Q7}QszP3:YN%}xZq߯`Ԋ)jTQ}+LǻSܐWdFS@aaKR t7i*u٤Ԧf 5{x ٔ6@)OH Cq55"q=Oij^ŕ&vn1mvB³ iU&UUI7CTϊe@:3ڈLW'QA@zWe?흂W?ĊgҙޤpC d"5!`:&HiEj~Y~lی ,\`}px07PD n a(КA.*fIyU)S~kB3{^F/^3u3@l~ n[ga|(!GCPʫZPu7BCќQ vmihs92gd^nO:>y r9\` ,25}L>Er>\\V$czcwSeo :@&F+q% _}u0t4"E|U}9in |6ю؇hT@v{&H W %O2A&BZU]OuէUw_Gh( GuAx9^P Ԣi: pήӺlQ \.BuCk ?dz$>C 0͈A ~W$ReڴumV;NJ{e6;+D`^3}l6M HBJ#a$胏FQn\7K/,8$KeaZQCG()h6V?|'v~I$mbvE ^кF[Xke Zn4FC7Kk7EbPL2}`.(ϖ-zV?C¤vh5i:NH58Kd(B옡NQOWz0- _KBpI DFAl; GP"J{ةk365v+ XQ;ۑ&Q; 3YW сVF8M0ՅJG| 쟦 t1$f)`})Un /_h Fz QyUf0N\{^#j I ͊!ZoILB0X˭OI!c>9$_.&LGu ^Ks*HbnA t@=~hif'„ mI"olT:F9q菑iK'2!Clml+ JR !&IC@Ck!z>ZP ! ٦!zzcF%A#ڰ XHŕVډ\"X b BvZDӢZ~Y*}ʐB!_0-a[2(354[Г#ԁg1VP tC-wkP!Mm ̙hAyVd:;8i\j#} !}eU!2b譣4\i44$'2)v }2 R?a[Ym as)/3U ᢕ!d, pK nymט5C{-5A{fiwgfDkXZ]*2ABH0XT h v$XntP%vOSge oBHC5 95ǗHMArE!CVh+хO B7#, Cah^?9+& akS Hj0Z^/72O׉C:-ktL}[c+"ŰuM0h_o7aVd:C QcoXH~f_ ҧ w1E WřRnrr `A3+ß7qG#v})l|^rӡw"آf)9vh͛4Jvk6LX- f6TTCZݧ On%B}řz,Nǂ{{&bM@h^ݻ~m0-J=g"tF z˸M/?IN "IC>k׶ya\GClxF'͜ZHK"H"Bp2{Bw/$َw>ݻq:6:ɜ!:Mo\3N1vJR"7,;LV+2)&Qw$3Xɰq ̛js~HڙΓbY#~r(WI5Ƥ},e<#ݟ (ko d,`E$&c-VqTU(@;Ъk61 E3ZߔlE2 g$:X"Vm 'Hm#Y)K`hhn;1qLukcDhZܹX3m5찛F{a 3* ̌s;Ľ&x!"uI˘KALɴr4gDb %ESl{T 7!jK$op=| iX'$+Z4ĪIE-@5IPbQsu /Lyԅ]v)JS fٙI{0J‚Fi1q L&H$m";F5S&^Z/nx9Fi V ;\Od#*H떴;IE԰(MC.Dp̎33XLY !BM71= ͭYՅT<tQs&v7; JU>7@HNBZ{; C 0C mRSFg :qf}bN`.7zk!ƾ+Ą! %++Pp"`1qG@|ӆ[S~yv`Hg6A\`ڃ#vy +-LnTca-[,#ISV2 zL5鹅`u &Ǒ@Hp:|{;_Y_tJ͍  uLb~t\2^Pt#~E 0$A!z{h>k;dB{[̸ Rx?⟱v-o4~,W˿iD ~m|[5|gMjz9[Hc/=Oa/$ܺn?љ 7|"g\icp+]x^y?_Mb"]}М+k1knII:!QRYsrh\1h7oN>^?GD,m!BD@p!a h| rcNe.«=Pbv6 vN~$qiRu`!@xkk< 5dn>-v3?vd+@CP7In !bk /?\\ب4_6`e_t;*vnįǰ5آ'4%D|ri"%viQ&^a OA z|;7{'V@b/Peu!RQW6*me|?//7Ɩ;ktV,2XRB.%F[>m؂W l0OuB9cl|S&mC X/,\F:!k6֖+By|hȲ?ߗke¿L{y2DM[p+DI3S/H)J?wي]}H@{%<0el  yumjqV[Fݫ΃FOoaƾ7,D9`cz+u$kI(f'H]UiOi+֤rߴZA(yOnlBy{ { }BWޓ4KiyB1&7̷#e0F "~۫ɨS1=iL7m=Xkbƶ}V%_3+4UHGс ݬY.BN<6Fb=MWlk;c=K!/ɡt! e= rߗkNAt˔KpnӘAJımZ(H#˱XJLIȠ +ְlRm`qIK>Ar -+껔V+B | 8;RA+wД9kkr )\2]k:]Ra&ɻ-_u)RҖtu8#6Z384N"|16 sIM,j}jW9K/Pp&=!nwnXo 0I}M) $Si8_Nj XAGd'>nA#/VEk5p,ܠI#6H˝amNe|J{E7KSoJ t7X <n 7) 5EK&=_Pv5B 3W+87)F/Wem,?ܻq젖-,rI#ˍܵV _ۡf)|<ؤAm:rxmhI׌%7Cձ@@ -h(o "q mT+WEg2^\."3g._7>,5\iśm:i%Ff<7RPEX!QT2Pɩx‚z~lb# BWu /ea,H`n| X(O+ƍ/ٛ@y-!dw"8ݽvNӍ*+, NC4bh6D, 0`3MۛOm:K{BQGCfn!/l.{è~ڗo56݈4bo4a@,B"לnxn~9Cnk_76.l\yNFHR01궲 ٌ'-thH ?o{P-cy8B#7SXR(F,ݬ}y~;pʃDg9c(QPghvBH&c!*2xurs]Pt#tehm v7n[MV`f] F@&@>*t{BL3{1/1wd6J>4EFV.w Zl| v!D[.]Xːٜ_\{7۝˯ViTc<*[Gt|MCBh|!h( #QDpKԥ̟Ѳ Btlsd3;LFA|D;o? jN$ cakq`t޸o/7_pl/|mq/|D%ĩ0-AILL{ d8B0Egf4U!Q@f 2fuM| D.^lEGGdibՄn-GGc5jCFy}v;vccMt{$FƃӅMyAjt#G Q!v$g2HɅ;:"% R sg@x[JZB~[ N:Lƚ"!3kr_|n޾ov{*46Ӻyse[Wp/u= v0Gw.l !ħd>!Bs U]BR(~#"Dh~NǫǕ8o6pxp*2uWԕ=.8FB4F3ӬJn[ϸy/:k/۟t:<1Ҋ}z%\k~?Ż}t[a7iІnTy ΢O1@"'0$o.䟚a,hx356{$nW]Jcͫzt1vF _w K)jdtz_DV~qe|ˤtyҿ^{Wv`!szQ-[ RBdVԎjvmdps];A 18rݗ>yr{cƍQ 9o>p^k3wԅa}! F2=gvO$?{ce?Ɣ-pi+{!uht6~^u˿YMcl1\Ӏ>b`N|98qp}/x$WC &J#kw6ڃ\\G6E?V.u{ S>#Hu~?@֧mi>#F1jRA Z6Ava~x^SA`%uwDg,z*8'wW;ڤ]ю 5}{yof]I+z3y}3q?K":_g kNc`b,B1/Aɤ"#HW'G«s\k(y Gt Afx~(Mxm2?9EᬔQ@ND وΙ|>Rvf*^q?pֽhzarm"+634<*HCl> <<ahHihEJ\iif zL/j |BRTڝkY9 cc̀d/VNf{Ҧ%bީp#Ho,RP1P Ы,GlWO x$(?1Pod+60'6q0$ 퍠DF$ ̏?O$0N>@ظ7g˟~_ cy oy//\x;]pX2zD6< ZM0tVN^YD% 4¾'ucq`lp,'{-() Cxѡ!x7x!A0@aU*$o;pF0*>Fe!a &gjg}}ౝC:XyYGsTw.q]C'-%HNc\7ڝ//7vk卍 )"v!r6#TfT]7TQ䈌0<<5-On}y[o]l5+ÝH&LGkcB-R_n&,8Kg'߾_i 3Vׯ_q`c?GZ$ظp2f4IxcVkmس DiU [Ig9I )ѻǿ !6-gB3|o"3M /z@y7Cs93!&e1^{}_EVk˵3+!^~@WtŚ]LJаޱLl=l%uQe`4v{R1p4S=0g!\nN=X'M_\߭m;GmL/DuЈ͞茋FkfたgҾI5p o!.w:_"5[kEi=xZLĴ1G)Z!&\6t! /tC «kPkpou2ˍ:u&0dh{L>>7;~Sq :7|t_pN{?\wP+"K z#ma-D0fS33m$DFv/F-/h7[s\ ~žqZav/0=n~N>@z/^>پ{rG`#־zA_Cܢ\s)X嚛DM& B>-\hƷ6{Fgy7x4\$Os pt3pQntG?gwoo\^+O_죷޸G'h>n}->v{tL&{/ko"Wݙk__2cO޽逑nK[CWe&W$[+wh_x卋_{o_/1s_~n\ :Hyj,|*-R!Ϯ!nWfړ,Ďp}m?X쳷W:/Iy78BǃT붛Av1ZvUUIDr修}?m_hO3+)§e1].$jq&P]RlM 7_-/d}"@6i8o=w0[dneI7 ayYG'{;!.8)6o_nƕ+w޼ƃֹC QE(Wİ!ck0H=` X_ t:k[k4AxqJ%Rl <͍5*H 2ӭg+ˮ8 kx/ۿ\~{`./|@ݻvaȇVn@6S^ 2Z`!Lo}mG;Zs Nj`G22Az3qSPC-K9O'๻] ݋oo\[rw~'G.Wc1BÓ^ F ijK1VxFE*\P Z@j_lDxldE1xflm6vs-:i;a"FOA!cjyPxpvVs&"mca*tܹ~?!4,Iyu]DOnF7u<yBŹ} BdN/ta]m tl""&1AJ{ۘ >x:QWZ K)Bֺ0UT"& giCFĞ1^6n \,9eɛ(4e9,gvRn4<|I=wNTh䃒 f@MV0 XNhKv&=7Xݽ/yC.]Jđ(TyOi>>o7_"W Fnwx[9挴( Jnl*[_Ja'4&|$v?mBE1v7x<M{ ;с.^npi={hX@E9{^ϖ^e#@81M?V*d+6b*!(uYBp&!ow}"Kzo; .y=A!#6 6E( bY̬r<`,QdN( !_jU](2RX"*aPG}$kuBlv0< ΃b~.ރ{{pBEW`q#!i8`֔PB|йydYr0^S"J F^vH4&G>+NN##0 KPmf5Eッ?&)Yu 4GMB)ٟDub}8'33|{&N;8h䣢d"4֟ Za43?2^>,q|;~bj/,D CuI Cc0?H .tF0<LzҤ M UrTgDwpAM1N1L4vZ]$W{6ԛ; h4jzQ=-n3Ih0bʣ@0BXMh&cnZ_/$d! wiD sA8(!BJA׍z8}b_DPYIfi*VWc*u14_B+BSr4DA/+t{O#ѫ tz:F:N3.IϹ^g"#WvT&|2RkZ涻`BI.#(-3<c69]l?G: ^oPaMl}. |80PTs)}eHޙUhƎGWrfB}dh_m5_x.Ԃ\p~d#˘ͨ]Vh|ƒL>3<;+ror9t ̲_3R? C^x}Q qsǧ6LrջƓ9o[S5RaάqҼj`tWolsG𥰫E݀c ew)g̅0 RN̰ =FN=~]vI# *Lzaʂb*#e.+E!9>.^jVMAPdV9EAπ2 JA_ix S!(5a8VΖ2'bVjoB.%f( 6";㝑 YdxtଃL*R HV@8U)=gK8ygP/ A-^mʊmݠLAZ^ׯ{P07=eǨ϶mut`Y}g}!|1/R %'YZiSdء04 n+ϝ2!BGUM5Nj(r?QFz"0V8 &c&heڕYO@ձvXBo5HnV_é3;٩A[0ϊJua:gfvϬm`_%' EwoB( {;MS/jKUBʙ># v&n\}u er]|U@@;L6xv@I=` p[VVv-kQe'ۈ.n9 ΦB͋٩)%0|WqoNB8D|U*'*I~LnzuHHkJl+3忣^ Al %cBcC!,Z CaT(U hRթ?癑ѻS:4E1,vv,ށ iY{Ibd |@.6J_Z1〉 哓I:I Eb 2 ^ M?-!ӷ=dl}X!@Gϔ &cTU3v FZ-}Pj whvApWJ||Z%gX?ӥQ$"qlw'Z'd]dx*$*vtβG. o *F% ,,a!BxHdдB7Lg3뵺ge&t'+;m-]j5}4v; 9yΔ># `J s_b)no9H[4=L{2"y!n%HS>Yв#ᆭ5B׵\]/a!V[ zt}uus `뛆vg21v,U_-3p т.諚bn@þ k12៫̓pF'+cf'MLpW+u/+һA8-buhppd]P^jWV64Pֈt3u Wu1s`t)^0H`LȼZ>o-f5*a빵S3kz}l:1pK B؝R&b}~<|Ӝ~#<3 ߥK]ݍ.gBϕ:!ݼFQn8ojkZK*{5L].ꙌVnz :%A5Cč6eJ č2{CUҍ^r3 EVvKg?hjhN5I}cQq mȃNnI$g8zB;'xAaB4*[!+P, oIC{.˲ JQ]YBزCB|gG:9qz&Oi1~}?OGѿ1y# !~څJm,S TxU=9'{-DвĞzio0l!OT !%f'țðk4*tzkt@O?/! <'th;9o^2`:r&0=Z .B4c:,6 2u`C4ZZrg,EM]QF$_s|g駿6A"RG/8hKr%'/2S14j,T, :e"Vta%Έw,[߆1B^ 1H8b"!8‹BF_W|:b}駟ză =w9 q,u"5mV 6^#=9p`%'+Vkji1`a8g833.th/1=<!zwC؃A$S{Ax /HOnT<#SUTE,̎i[RcOV- Ȍw0#=.m}N?Wށ`3q+{37!ï JLJhkbd& A8!DqE8>9m-=exk^)o4jn*308eN}r&ǰK]ċF5ejޛDRXd\J&!:Qþai@RSbKsl4Kϥb Uw΂#Al'Q9Fm2;fz)HD$ inތ"gO&#e9 =~6dTsdISd BIwC5_cx1Fڍ!<)̔hssk?E-88)vF>5hdqyU'´9("|֌Ϟ&,^BR۰aٞFm0]JaA(Sk  M z1|F[y}3㘧B!b4dnM7՗gD4dmҼMK*}ޟŖ EOepCr-ٜpF=$#;`j ;>G8P47W l4J1%[mݾ=BA>5RH6|2 &@՘Q (xi\bG$d(v"!S,|m۵gbCFU~3 [ 8}<8`<:5(dCboM4Ñ/sgvuA* ?)€*9. @{I+R"I.D_m;trߎ;y@hhS QF6vx;~@-a:]F ˳0x69x.hw ū> ՔJ,T?FH22FK}tQNoHz+S5@}_ThjQ]ϔݨu&Ff_O@50'`P={)H܏"NW8]#r%W+x"1^qDUn,zh`^Cѣ oa(S)D$: !-7!r'|O!J>-d:ÞhG[i=4媃NBޢnLHu{1Ҹ-0*<]߬cTJ wȄhj08 J>v*w/&. GG2hN|\nw{#ʌ>dOGrC ^~T))j(%2mGWآDnj60;ܬ \ t8mG,CBM{'dt7\E%ΥG]ƪ\"cQH {xW'p!R>il[@P$6[ Cg21z!ȌiDP Kˊ"1g@xQ&?B8i/~F0FӸ$g!X> "wÓr믿>/ /\Iݺ7*y%hCk>2ԔP0$@p~bH؁0dh_g Ũp,1Er6.3̓;r a,Pϕrjλ7ɂI1vbi@hDxxaTh? OFĉT^#K8"L9 ?*E!Q1ytrI߅ӯ0sgċdrmm%t.R APPn}j3G>TQ*.@p

@! 0fĀ Q Af`ն>:,{xAR*aχ Wvc2Io\:; F/W{F,B0v08Hd|;NƘ_"| ZjWj&!N R|#!)u+|4 4 ˍлi86볧1FU'@$NJNf ZPۦ4zGc35Vq># ah VslBh<4}XQ 2}9)(A\l378[SPe?5#UIR+  IRL ǯ+o%-cIXU<u:$WC!z!fB5CV5"6S1tO'4 dQu܌zɃGdq Sf"rݥ4㜌?7t=h?MaUXg@,p$#\^#BB3;B Tبsm]CwMVte=+BgVNBd)B`~ ritz;~pW`Й-O?ͳ[*_ʟO~}?_3QE4 IUf *IdD)% nS t|Ǝ^÷BJ2Gum.2Qg7;Z1h3&8ذ>31>,#z8ڛAì2c_I^`2Qy<£GX^ןɼ$4b8KT!TF0¨zjsnR75* •FȨQs# nŹ)8+3Nls6@>sYDcV;)& |W1R ޜLn}}>vg,|.~;t} OB r1 AzNR)C+WpuVgOώd 0D TI' 1࡙W-Є5w=Lb+SE*l 2-a3&@B`g6xm1 ~mǖ Ǖ\P2x Lqi{椹;ٺ 6;|>&T824Op >xI_It5>`!:.+ z V8AE_7NvR.Ee,fDa]|)5$KP!p1bZڇcVpsIP;ͻ-eJ-TvdRMN]ٻ}2,A/ϣBϨ0w{iFmP1H5V[7[6# r eŠQu!ñ̛2g ,ē^WzײmWw0ofH;c8n <; qvD W(+ ABhJsC8T-cیUuNǯC#1p}Ba,vTH=]xde6\Vb2kЛ 8m3*L)f5!)k]筂-B_Ka=bٶvIa!G=׌2`X_l!!0@gL6>a&AR1NvB sD6j*sg$>ޤw1*SᢥB,^tZ@lu7C#u=k17Ew3;,0a軾c| )w.⍁`7b ~aaxl}E{i<|nIsoO&;z 4IǪcb0LwKܜ' |F:B0R J9LI)G++IWo9΢$Q]LyG!]na¿W\^ tWc<v]q& G"B8n}Fǣ(wrҎxLo;YwdW^SW!ߥÿ~Z7S.u% 4M2 `~RQ vbDFz6S,¡ aC^cL3nk|!C߮°o/ڥ~摲+X ڭ`=#:ͭaW֗__ݸ'xln{YͯxũI LQo+N.9_M $7{zuLAMTt&V8w`c0v~-xzuVL@|M[ gdE 6_B7q_ ?u;o}zɏ? Ҙ[NlFJn"iT 7M"J UlR\En9?I)IdtsB+~{i.&Sc!p]I`-\pB^0wFyB0: EW_=w9uåGY=?N8x;މ[Aza/H]4iuI` !WF0ta)ɛidWks,1Dkp?6ð}C)& J3 R]o#HRwF>+]-(^ʙpVb^B?^J0tmܱ1${mFcV 07Ҿ#V¸$d0xWdBؗYc6}"A*\Ǐ~wި}R V2@l}D]h$ {ٸsN#RJg adv; Bޛ[-2(J̬|!OC9*BJ6%:[<,$K־a`kaNCp 9לO܏zAt̰!D{LbIT1 oU\qƯv)T8~" LrC(4*T XۡѮ1J/("( {^L}XFPgj(nwmxnZ6l.ez-gw+l@~*W 'EL{߽7GbD?v*vE*t]2 78"<fs}:p.B.z.ZP P&Æ~5Pkx("G'PiaL]~}!ySwǨqRD"~YF%)d DGL7z̶A_u)07h=לb %'AA 43)|ufqC5t R| mɓH0Yj`규Ёny_sC Bg%#<Т'2Q;&:6`Ұv[FᄭFL *@02/X&Q\#=J?tz]2s^?ht WW1J9Q~)'dH~ jpQa(2dk#DS080thnhذ8TdTeYC}nLS"Ci!%)Dh.&@8|v ;Sg}e^BT`d1,/d=z=B-"C1 f!\EڡTLRi ZU2ՔͻJA4T(C$!=Dpi ژA,1ez$~W$pGP n&xzD~.c:>j}!4yHW<1~F[l1e0(~I ; $7 WjgWm1Znl2dthqSӝH4-})~|݌G Wl"_ʷOMS6y|IiaӒj8!Qeb2w<EUh)f$ȩ ޭ-*IA{vvoO;W-En)zM)-am1 s LЀ=b ]I#aC8!SgʣdQ S3Rm? ,@1Lsä{`)9)ӽc /\+ 42S>D?y!S,Z1#C6x٘H &8ԙ] ԋ(q8{_5MS7©є:OJȗO ᥨpC0Ehzqn0x&} <&oXt*UfV.VA]Nj-Ƅ!JvTZ9v}#wZ y0!* 37BxI8rM Bdx1)Mxʽ"^)W3u)E?nyWT||~ӞD;K XC0 j#h[11 kܧm *,ݳox)pNu+](8#I@v蟷 =ףD?t{ Yߔu> E0 r⨜ʮR F6-A!D =FF2$%ּ3M3P}t?8 9a]jQ_QϓIL~M7'ݸ!7yZ7g\5u -:8pd3n{vEPYLcݞDq}({4SK5_#M{jL3T8ia*Q?"Űl13/J{SOjs ]HS r[7LbcQo(p% )!.vwڭ>ГkB=^|UȖ"Jk0MfS r/1C8mj {Ԯ +  6Rzb ywc2_3-ZC%I(qDHY-*t]1MSS1[BA;> $H!QG+0u4ho@qDi!QklBk28"7˭"1$R e9Nk&x[$ý|A:oH. O;GJð4`j uH!7UKkh ੝bW?V`.LHo!cfeDsJ3qO(8JK@N|eBhՐ< ýj)թŚTfBБ O@8HG:EʃGGbO 0JKaLWXRLb#Kn1z `$5'CkuԊ=n!8b]?ݿלmz1~` o/H/Hg9ewFXE/Ҙ-iC3`BѺ;cXk6} ԬRɲJe-UW-ZXZē(x1v^=`YGU6S1R?fo`.qn PjA0@I|nfgx^CR!Gͤvo%*$!˛OM0c+̜1s@3`]:!IE|xLosi^V}E+9 ku[וʶkb>W7˚*lgJ-杖Y*rF̢R׬Ьu+qVȓe)St( D%óhPYbBHZ eg2 [uv9 PV+BZ]Tٚ[Y-o+$f]Uv֫SdeQILZŊZ+loۉ3lΰ^/PICQ_!l x ]~Ӡ0$漄o1ĭ+ƙN `!Tlxo QBdttZ#ei~Bsj̞wꚝQ;j<ś:Q~Irc_p-uwBY`{R%=Y!_dv)% 9>((NACЇz%CCj2OR8tQ.H_u^.1e%᥸} L 'fk"~(vYniȕR2jS CNa!!!M4SPRB9|3COJNmp f*x1}O1wfL5SH_BPKRtR3Jǐc.Q"Ma4"txQ[Ĩi;(HBCΰkx ҡCaB 1+L bqN`ohh* !%(WeMV=g ;g`G͛ X-%Z\!3')Mb}@)%`?4Xr,ôt:j빬k0*_d=a:R`1mf\ۍ)J ehb aLHxCP 7H". )>u U *~*ylBSV #ƅh:+d2ȋSв(l-c2UӆAt\‚fй˿&e \(PvY7x5݋TX9S'OQ8.!Ђ5Syqf38!Rc|K3O%צ'Bmfz/9JyUa؊[ 2"? En[Ȼqp׫t(Z0LWp^^ҝwFOEh4/#2VB6PÀzqĮאKBM)JF~Bx/amҷ?^?,hJ24D&^Yr„B&WCڌYnq0ck0Ƃ`]aZ s<疲/zj4JT0) - ;IQ)QQԶmqBjnlۖmYw΢jCNu D0T P 0eGn NQk9JTKAϿkcP`j*ĐVIHhȮ퀘PrUIqHǍ0mp>^rHDҷmkJb(I0.C@Q"rZ.z|z5D0i&O&߇&yLn[uO+` Vsi\9LPa0Θ4G Q[1!`(/q 욡Fl9ތdXOɜ+Bixf[p3ֽm_^grR؞cç6Vm rܮUE\)7ā 6H `jC@wZhJSŽ7 Roܣi( "|w9pAu(Qkc/)DHL_p~.3W` agpv֚oyپShNݱs?U? a #$V]18c^B]H5i_KgoQg TQ眅Lun_:1S S0Lǰ= !F9>^ Bg Mפ sQi, aڤ? $;MKDT_(ɰPN#r&pS)9JRsR 5:OlIΪ:.D F ^d`݋Mz2-IH͐!RcI"55|r9dI*k*> >zY7U 7m[`^V;vF(Ļ@OC@nJcZ)RgTR饒HHڡ᪌T`7A3wFjaY>< թ2d0RmF`fO a:|/%>Pn_S~5y$ Yς " -+I"Lx0c&*C%`XR+SF@R4ŋFi]B兲V,l_}L tI,zgJ>-~R$S"; )j)7-*4wca0%9<>=ڂ: [>06WH´(U̮!=ϞI`:.t(HmE+YÙ \M101ǯ?~~h n] .z \>H$-r7SB7/MCߞTE6|h2'$AΰQ"HkvU%-|e}.Ig*e}qIgx⵷B*'N&QX& a]Y2_ ̧ou.6o!Z rɛfasE~G$r@ҚW֬ !!TU$C immA# {NzS0B̤(r*@oH.J|Bj[a/*e`V\-- Blg~8>RCwTۉ#)" %2iJ4\!/FՑRos^*-= svu~L5GZ] Bql3ֳPsJ*납᪵kMPOPu aIfB* 9Rߠ`V-El}QEVA:ZBE(G&|0tDm0L{^OssxTwپ3޳0Е1'Ӗ iW\! cEFtdEih!zF_~|&j2Q5 i Х-䅆JNP1_&X`L:A_Ͼk M)-XL%I.J%䝑E)>+H4)e 2lKTgRs?u}ja$(hUb* DsaS<;N5ZQ_h!1C)Np0P]0TC>0A .* jKߐo]'p[H$*٤\#TbTtz=]a "Tb)GOFºVѶ;,B|Jؐu ïzA\pk0&tnS?)B-HP aFQɖե*am^#䍅 WKg+% v2 SSk`bYsQJXn7VVh [˜HM $n_^i~ 9c^_\)FI_YX)3$2 4 :έ 9LF>g)"i1QX!1%&2ue/ػ%=[R E#5YDlJ#D5&~@HF>i]9_WiaIC9Bt1HDi@(@bC Q1 } !, hЬXA4l0 dL\̨$=#@^LZ1TH/U|#U]f_&nt=g We]_aAH_ˀTTnE_'SF*lo|ecKDa=+/3fƛ~ycV(0N Z+L']-e=X56|Ût``zuǎO%:8Z >WMվ`TsƦo1ph_}u>&WgdOg !Txn2Yma+++UWLM~Tfe3'歪oV6z!畕 DzNUl \e#C6WZ I{cJ[ƒ^6Qg !,5##le1 c!Iy՛]+Z^X-WC1 h@ȉvDLYsIeaiA9)3dLURܮ[•๹ *F2̬ !J)R&~u}|+=NDo)3ۭV x!*Ł$QMr![#3dPo8n rHL~ҤToŊsvC( zjE;(:*KۈĬ7QR~1.(v|!6PxSyiy[n ٿs1z})UQ+fϙ Z B A÷6d'x$>S+f?qQ{26 n]_j/_ŴYBh0s@@X4M3?1Va,[B9޹~cjq=8 B: @Q{/| Đ܎6pD^Z%Z~dJe'ASR' I&UrCE)Ĺ-@]|>g%H'@Ro=ǹ 3.nZZVB V iG^_x%v\AF0G,xϟȈ ?*Z=0po \OLq}POH'\a[uڭZtzvi,-kN M.g t ~| n?b̃#B5g@|\Nt<&}Sy~G|KLT֕A >C q5 +fM)ŲPzAp>8 $yFTj"9%arQ|7]@S=;> stream x͑!qG  SzOr9W&MHƝhT(\ÑTLޛyרּd`0p5>=r4d2bl6f6N|۵V~?͆h4Rv 4z8.KD~?vu;ΌpEF?$BMM=g,lb53,4f;*]@"e' g8ɨ.*^l~p䨂 TMjN5_Ţ4DUf%Fdb#˦s鏩TYD !J@ɧs(HWsiijPh2u ti,ef@(^kB-FP"*AxyhkR 0)V{z]< endstream endobj 5 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F1 552 0 R /F7 523 0 R >> >> /Contents 6 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 6 0 obj << /Filter /FlateDecode /Length 2723 >> stream x\Iod53Ri$$nH8 n0ܐ]巸LF&ӵ?.OovWslabUE]1&߯o?_^. o+74֠H132*GeWnf-B]-wIpK.=O> ?ͅNnS(XE<9ºAaAd:}|v2"XcF't~)f?Uʘcb6Dž3|y G]G^#ޙzNP ݯeˈ0iq?@FXb2LVnR@TӍ,t9UjR$ t@'*,2K'lAuaϥ! h,1( VrBt4P)C$CN9Iq5JܠGUZ!]pd B=Š[ስݙxZ.zœX^u Cndqi֫]ҙ-d>e&=uĹ+|I j6!27܂Bσ9-Uɯ`͈bTwiSV78`e}89ӋP;+!,GȮ~1"s\iG$3>XX9oB= ٮz~3gh:W„KQ8*-4Ĕo72xd kbrjg&։s=IrOĠDJ'#qшc7H|(zAz݄34eFxڭ[, PP- [!PFdAf&&Df1J`1H MFf̹5Mipȿl;JWzOk4BX}=B޵~rp\o>6l&+yz0ln0%ՏZ.n*.ڢ`\iJ|g. .Di9o~rȆzTإ,EkkvJZ![KbQo#=b)߈wKŌ1atH 3L9L+r1L$4r0Tڷ9Yޗkxgת0]*,yS hF̄p_k~Z[}SRkN^l;7'֙ ld_^}6{c7Õ&ljOrݨX~(< +R1cH,+iJPSDK* d.2@mWW\& P|Z}P zS`oDyu,L:#1v4͗m]|o3*2Fu's؞bOԶ˫E{;JEܩW8t18Oi0^#-"9e'}T37NGSZl. i[)޽z^V/+z^Y{Φ3Y/k͂y} b>]Į\"ӑfyv) i9:d͇fh3BFcz4( `,vr_ dU1XDWr16;2dD dmԫtݫ5g}*!uڮҏnnMX^/ ~.F()#o+6##Vx,=f7Ƒ)zZN7ֱ9Bya|\dUlv_Vobo<6;^D7'y|(ۮ UbՋE;Qpn6㛎4^}N?^&!E핡/d5; ΆAJrb*t0L%e,(%e#̔Òb%,ޛ$&tzRqsTOǃ7W?t I[zSS'nxB܃oI:I,'('`eZKt]He|L6:&ֶ/.t)-a6n3(v&8чp/2ӑ0N1)X ˁ9# ҤnK7ÜA2i_R@_ڵ:Ea0'`uzv2 X Ѭ^!i}L7:W;|?L/w@VBnM [yR~V 2 c@9-JX'@ta' ly|s%K*tn MѪ5,3O-t0< GtXsT_~RRv$2x vc a%,$HcA}V <74__-+O(|3.}K*"aԺ-p<8K:2 Ɓr ri9ܹeBh#J(DŽq2iVVʡr@6T|Nv|Rm M"E;~IaV> >> /Contents 12 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 8 0 obj << /Type /Font /Subtype /Type0 /Encoding /Identity-H /DescendantFonts [ 9 0 R ] /BaseFont /ACHRDW+TraditionalArabic-Identity-H /ToUnicode 563 0 R >> endobj 9 0 obj << /Type /Font /Subtype /CIDFontType2 /FontDescriptor 10 0 R /DW 1000 /CIDSystemInfo << /Supplement 0 /Ordering (Identity) /Registry (Softland) >> /CIDToGIDMap /Identity /BaseFont /AUQYIQ+TraditionalArabic /W [ 0 [ 500 ] 3 [ 244 ] ] >> endobj 10 0 obj << /Type /FontDescriptor /FontName /AUQYIQ+TraditionalArabic /Ascent 994 /CapHeight 994 /Descent -500 /Flags 32 /FontBBox [ -126 -500 1006 994 ] /ItalicAngle 0 /StemV 87 /XHeight 656 /CIDSet 561 0 R /FontFile2 11 0 R >> endobj 11 0 obj << /Length1 14857 /Filter /FlateDecode /Length 6783 >> stream x9i`T73W!,"[@ Ipd&d$aPܪQ"ZօֽVkj Vjk-kνL~~}?ə{{ι{}y -dGL {[Ju}p!pc_^\$TsWmMo}@$t(%|'1R< 9ݍ3/H nqQIݏ}ϭ> k51vXzD_ I6LiXuttKQ@(f5i^D\BK`"Mf&^XF Ŝ Ĝ6<h3(k!-1eBglOHLJNIMK1v &M-LN˝>cfϙ;o矿d+ VZ]lm6n`s喪ꚭjmqQ OUw^~N:xϽ~C#G{OؓW}('?}g=? /+x=x)}}@& W@`*/[؋=K%˒mYnbXܖr5;,,Zj9aO9Eΐ'Sty\~8gj 6`|09L. 7k `G3xcm'>;{~}6x{.x. )-XO^F5Rh[,#(3I,b]źyp```X-MA[bu}뷃 cekkc }j rP%7\9;p@7kynKH9ѩS?ީߝz^;'Ok~{-u9*u dQWZKK-kIX:տXzl,ZG`\1M>)]e$۲rZQgɚu-B[W#ɍm,KE ~E$H$ѢنYMc!sĻg樟R97kJpLQCSy@RG!aFZd<c˧\IsȌ`Y̔YYZ+6>6k1U֊m61*FaX1-,}NVan٪o]h\XۿeTެeUNcކ¾zrnǺgd.ҡ+̦SoŽjT3,?IbW*yr.u (GfI [Ek*14-8Х3 bJp90k:"./?]gыS @z̫}!v̹sĘDi} q!Ν;w261D}FzU`y]fIG |O@5W,`*= .iEPAJ2rz~3oyjoe'-pA=- 6i5_@e+dG`k oE},{`vp,ZZ`FOyR=f>xWGmtrMl(zIuڤ= tMyeE9$<N>-b[a#d?Up~#ix/>>x~bhhu|_4$=aC.[a퍋̻`+KqRf@}DI`5gRO V&ȅ Onm&u>hM97+|e:=E(: ri\Ax:/ |~誮Kx 4;i? OиNʘ+1>; JS.A;հt7himdzKD#":S+!]RIyC$)湉zpqu ȥy׀ĺH]#ru? 񦓰 qM&bԀ40иφ z/v_MC 9th,!X!rV:} ZӔҚ᭾ɮX4b_M۵uΏ\ |?d?rDБkѼnH$jkJoE-yθ?eE9J59uV@hMETȯxxVr^뼖VASN ayZ{]}-^:m]KP9Ij<gY0l#F #0)|fi`NTH g7 HsrjPǁ7oȟAHDρ0jMXDp4-B:Q*Y `2ܠ&ሆ[ ௞LqD}/j84|D$.C 7t̐ɲ4S٢i3g -/{^j$*\e\hRNNԨ/w5Ε״[\NO9]jbwqM^U\[͝mwMs"GK V]РfR碶| L(Y.eOX1L aKGu+sIR o tgtOdkl}G/r?kkv ; zEvҬ줥[QD5 {5(ۈ%I^_aC8³/m>_ Gc9.c0Z&Z @K>O Ja m0C&LhLl&A.L4<ȃ66|?XJ/P+aBJ B9PAJcp!ho.: *iS^aEޅ+V7+M}N^|%=y`'k8g1 臏xށ1c1ś$LL4L1cqL1 'd(cNE+N\3p&0gp>.c>Kp). p%XkK b9Xp#n pkp+^6mwxs8oZx^bG&lF'[ ؎EpnKR /+J kZ܋a܏7Mx3ނ6 ]ޅn>(>G1|O>?ƟO)|g8 / __k: _{>~'~Ǐc~g9_g ~ůoxOA Y'J>N vO=$67;7Ưw9mR)TTJԦMnrajx%r(PxDnU$:I!~=֮P8Ҫ1 Y͂i9y̾ Փj]3&iwDRFRGQ'*%хQ}ҔSLͨR1E:S3iI(Gh~wN~g)>m~U;GR&$A׷qb pA\>OBΆ=hrD/5Tdd"vgy닫J[ZVNGryΊ*|vWK"s`wrDÇ(=bä}5:Q̌NDzV4:-taNJh(p)PNXBAK5u%U vv$B،T3@3# 9S PU3U/3z}hK]c3(]G[HGe.S螚=i+I:os7sMd_FY:sctq#{DƉ,QQJQjI6^mj4`^'2HԎȎQ:wLS/B9BUl# ":/5o)))1ökJ%YTko]Kְ+F# 1#G:oVXu1~}PW:oX֢;z;zLؐjab3 q4?gC"vSBNrEq_]Qjj\{&I,]+iXRpaJ= %KPCd5a*i- vЅ^.ω-S1192ːHt%x ه>S>$ꒊQu&rϺQ\ w^0tjЯ7Cbc~ݘȘ_77\*o7D"s\Q 8B5H\`(amzh %\T:qPMx ЏD~dug"a6'TEqz+N^*(͌sC }= j>8S #4CߐccP4{t͞!͞!;zr9S$TˁK8Rs Bd&}e6 ̦-~SoLsGoo S[&\LMPm]qz74zOgX;|JlM0dBwC.ny[Xpd+qju-p/C>uS#xBn]5(#E*tTǡ"= Jc?=vVuPV:F"?~IuGD endstream endobj 12 0 obj << /Filter /FlateDecode /Length 3117 >> stream x\M$ sT!7 ;?$R*QU$0uOw?QE=v{vݥX? !o}vLmfi*NSyjrK!xQ=uyopَʼ>^^#/RUl0w)~ B[XU k-qem>[^n0bc_ }{fUI3djK&m 6_niۖpMgOKP8|ou8&[|nQ"Q#v(fdwI%KfٷvѮxnbwb1ڰhHiS4`K5.Üଊ1$hXNm+1i hҴ )㷀r;ѭ1rVsNm|`-<^2neNp("5/Z~iGyYB 5l3XIRb(mKз(*M="=.!6V栩ҝڰAz&y$W';D ,}a "6kSѤ\ Qz`P%룏J+3'g̺-^.DZvC8]jDtRҴV wj`t疃0f+: +:L yXjNƊNc#ɏ}#94$6)=ϕRQ6=Gf$zVqlJcw&56: jJZ#2YԶ,$p[<^G Hj䉶dl$X!2KB֑kL!`n*x1A4x='d/n$dbF^)ksμ.}jMmEky prU%Mz1$9Hy;m1}$cdd#;ܯZ1'!5LEwɉ`C^Zqb-bkkX `X1h${^x`Է [e5(m=E.&,^n(<{\)2ٙu?\+.*32[bȉE%)h_L֡ V5O ͱ–}I<^_V,=}P-X8ZCiTx] ѳ@TUj 7AAmTbK@vR. engYP$LĽ~iFPOlWMN }w%RέjKUͅ[arGmEaSiBrAYסzy~n$9Hn,3 y$7I`,c-пqi@ hҴ 퓜"WgI"9eʒ9Nކܒjg%msFOef֟bʓ'ذ }P6F6 2džc bCHpĆ h4mCl(b\cPl(R+ ECTC:r߫Dg5c:rXR wHmN IrVVgͦ i"X<1h"y,1I"X1u9h8PTR(FܰAg("4?=~7WDhnc`3? ]<dA}'l3Sb"iwBMIȡRLRDȔ!5)8t; ~Qu8lMb@mhOZSzj?{ӌ7h[`ˮ>01BԃXwzsZ`dz!} 2 Bcb!Hj~Gf c-3r{ @&hFS 0TaϷ?p endstream endobj 13 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F5 574 0 R /F9 493 0 R >> >> /Contents 14 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 14 0 obj << /Filter /FlateDecode /Length 2077 >> stream xZˎ6 +qm ̮h׷$Rdn1L_T~^~^Kusmzs2ɫ2~u{ue8[&g#Y**:3uN|ӛ|9JV]Ԭ¾;_}/ZoֻJپ$,ݼ3KZmȾݥ{X#Ǥq['7'lu;~N nm|ʹMVz; s =j4Q ^e>5 M'u)ICĥZ= !$\7 D mqͺއfvxf[E,}=j;A}I!2crK`K0\Zs*M ̒qm]'Tn{n0z^X Iߢr8K߃4GobVHeyNGd#*}%fQj'3'Os&}3NxV.dm|.[x*얋t?Hc`t`%i)x΅wq+%O2;C{x#MLB xa+x@1'l+4 _v{s&ݙ+_D$pO-y +q Gc!FWеL0U+ \L⻈`@0rJfivNhϭg&ТSuвcyΛ:XmjNAYB#!z(g" 7;QPJoBNpRL c)T~)c 54AC!U./o"TF0Bt,I[{ ^ 7m'2;$ *"[l:49ޡh/1cJ:R}X+ 2U K--jp1{7cmlqkB4W[YƼ+D ETo8Vmk |!ZkqAWXB/@OeM;MZY"c!A\hLd?Su`'٘7ES䐯 Eٟ:j]A}walD0~dmZc^S̩FEgat&W:/$BF,DU~qj ai2q.:V<yV9i5PzTN 0Ӈ"ؼ_duf]JQX3u1t2%>تC@ RͅR +vG>֮pUe?Wiؕ\74CXN bױYI@VIeJϑ"v$fq<H(}]ƀ-BEK~VL[\& p"-td,ٴ;W !zv@K-׉^%eؘG@gN#mhM]ZR9:=8 t@!'Jʌn7^VG6|d2+\>9:ô8bjזچ3YJHIn,Hv2 *dg]S܏e?"TPₛ I&Y oכ#7y Ņ5pB4-g0O1,LpD,mTERۣN#b+8¨NH>9k[W.7)6 ^}jȂPVkkG퉵gf7Gb7(bn1<|lv3DQȋO?~3^{2=o gX/m/J&Jq.X]A%ѽهhWG΃A̚Xޏb|w)SLwX/ûS3jujΝ'y"5ؚ{)1yMb)V<{wӎ;\`Pw's endstream endobj 15 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F9 493 0 R /F10 499 0 R >> >> /Contents 16 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 16 0 obj << /Filter /FlateDecode /Length 2290 >> stream x[͎6 )Dz%``<-0=oPK"e.bNbJ?ʏۏyw~Y?ok?n}B_or}B*K9I ݺy$6O}y c9b)[wCǖ=>NNۛn<}?d_ynI?t\MͿ6{dκ³l\@2MaGMڍDe/ 4dyBK `+׿ ;l[}7="4WF%-AsTe0>`Ì$w:P;x<69Y0ng=K_rg/JCDp*a>cg+6F{p{vH/U2):Ah +wjd ;Bv~?n[l"[Uc}1~x1GDy6RDWV/L`5}N81jh5 l 2HCNSZ.^YbSj,~(k)<{IM*jb31vz١M}@4itf@|# ̔/(/.hȳBVn#ϥB5T7.omyCHPJ6ϚSvfV l=5URf=J%%$&N0olchf.ٗ_͎̉}kH4 rNFóIxqs XAnBrebhռ<9J Sse^ hkZ4&wk[G S3lRJҠN$9o5֨B X*i5?h@W`ES/[O܂g8"] 9i,6cg5=![7%J{XHVΉqjK!ml S҃LWuǖSsg&qsAZh:]K+2.+'Ehf:e)ȝ@JzhKvhGݮ4ݍ\ޗe(Ŋ IWIh^ 'o^1a?e%3PςP&"yO$iL5`\,_:gUJY@';OA DJ܅K͒e?chyQ Ft$PGiaݦEZBM4ƖuͤM(04mW+Y!>4AR[+Bh{k.ˤE[l'x3cy&Șm㢑>.*fD֘ok6T'P#nX}z&Kk.bJ۪3Bx<&޹?2D5QU=/fR|Gp[cڐCd?J3XMm{cA 2i=^#3V'k(+wd1B VcBjLi Q OOFڶ`.wΌte'j̮9&3Zf `+qbWX< qePo7vH#[b؈LF[ ʾg9 r,O&VXǙd1Z%TLupedXg04[|/ݫՠh!n=._Ԙ4--JZ-?zf9v#7c'%i*WJb$`C|%Z92 ǡC2ґ bKsrht\o,U`ԹílaƗ]i;u'T?l+lRI=2AV=6 SqKe#UWħ_ދo2*3ejU~{zKeJ}b o%KTܒ"YAA.-4V(.APV; v~'20H,n8(=VaqdQ]*w6?.g_h"w Wz_f!fKd^up4~4Y WL̩;R>VM!_/D@|TSf3TП q..6ZnTrw5ƵB1_Qq5Kj hBKH :Q HK֦*.G endstream endobj 17 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F9 493 0 R /F5 574 0 R >> >> /Contents 18 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 18 0 obj << /Filter /FlateDecode /Length 2315 >> stream x[Ɏ6+pD``mI--9CHVQ"iJzL`0nwUW5"?]~Z_^ucg__~&з߮_?_/Glʙ<`uW;"렺\w\ME7a=!o9sZsn1 zc߃H=ۇz@Tțhg{wyw<íq)>MegVv<$:>N*n}Dѱ-9|BJXUK+#Vҷc|x>t/⇖~f>R N5 1{PFg;`>^ ?,k:?;D3f-jY̕)9!|i[89yzb.y~<vŹjS%9l\"·ٗ[80A|a#M~73bYU) %͟` sTshvBꔙ'6%|j6+[ULOҫ#Vχm_}{R!j!']$Q:T C |";=0Q{Qe'(w)UU xjZMh*4Zɝ;Ϩ20'\ v8kuE7P[!чgLiajIZk{%d$?`J:\57L l.C-Zfp>ޓ/ [ 1Y?N1H-XBrj5dF;T(o27EvYR/xeʵʽidQij0"2L%Erfэ,ʇ:11?.roFuCU6[@(YvS/b񑴄MF9BLa).3cAZ@9>YB='Ky%ߔ} ?qĂtTr|}Vciz林.x\{H#gd~.&d @Om @N'} -Eҧ1>365͙̚ePm*f}4\ )`2KttEf߄y36JPXo`F&JȄH6"E MfQy6>^ƜFrrf=W6c"u|rO#ֹPB%IO%[`Hʙ2G/a Ω T\&[$/颸Gv,? c{.kSYF-ݔCL&;\DǹPN"P4ZGBDGYQ00>U0;!C[LFDa9T2LJ dBd0t>)u]o5@[cIՐ7yq U.wPp+O=T0 _ A /dB4OzAD X00F'?>E[Uj *S;C%~(-R# |)|ઝտߨp\3O_zeҺRZ-ZZ e*o"d};"bۤx9%/X:֤P(9@("9(JxCH9KrN)@ͼ50'S%=#k 5b(J x1CH( Uxe҇V(dרWF`fJ4/{nhtR-Ivsxd5j@KB/PNB/"9)B&5$__Rڷ>9|gڷR,56ol@_~Jg5_AI|WiP0!;P&DrQ,FIOsG܁ߴR^3y%^%yK`~#Ό7Z[< -Q,F Ĝ$ 3#) 9>#=9˿? endstream endobj 19 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F5 574 0 R /F9 493 0 R >> >> /Contents 20 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 20 0 obj << /Filter /FlateDecode /Length 2221 >> stream x[ˮ6 +qd]+c=Eɲ`PRuH2_5߿_^(_cr}'&D\V]W#8( ZOWR11EY+^%tT*hHˇn?s'q+>3Ft χXiW s=8q~g*_SWa`"널a2?sV le@,d=ԸA{s|T:3pR $`rz+đ4DYh=#߇6 ,BdH7oO.90>s"BE?BT'B%WȤ{o^rdy|qӵY(E4EC#8X(ž@gF WI^0d1&n ؘY@ DI4!$m M>x]AN>u>; 4B(MF@$CӌC(@{ 4X2 eO)˽"%Cb{_vq 1X)1.! 3ce 0c1%bxտ&"}Ud˧r[kcʔ`5\*W ج;K# !H(~(C㌴(( ߁Q\dKxRB_<7&S9m紡ԇ+O} yhx8ܮTSJIkE~ikIOҡ,ҩgĥF0N%.^MxuC-kqGѰ@)O6b-uP˶JJ7¸ْm]*sKOgz^O[)6H`[I%&&9|ln?O.\jޭ^ u|ea|>΍;`bl/x#ү͇5aM( Är-f ?@>/**\e=DhF0KuQ<Tx [TxBw[.fF[k.|Wiq2'/RŽ{nBt4?cQZm)dkVO$sʪх8*&&hXa- ^*^lZõfyug:ʠ/h q;xÙ;))9'K:IJ{ZX0RS._2o[l` SS]aE_3߭4*ܶuHvXłs_jBtZ!jg&@B=_Os endstream endobj 21 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F9 493 0 R >> >> /Contents 22 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 22 0 obj << /Filter /FlateDecode /Length 1467 >> stream xYɎ8 +h ۡo ֘`$vQH}}^7zwwkwF 5׿߅!R*u[IXޙ ;Vx:z~+iGEzj>牊SDYNCp=-8RY7*??u;x`KMI; =9.^?' ^;aYM6\z &_9r?Ee1!ӃJ Eoo1Y~ \#q|z3~psMp0MHGno;D8xE7uvpwul"ͪ5NUȤ\Z2+1h+TYkx>1)7-W4\A<˄q;O`k mil#K A[!*gԦoAas $E$!}l,][F,3U*sDbmڲ<\Ι]0ɒj2b Q̘aQ4RUjkN^啄R!&r(fj+$5։X b<J*pYz6t4RYf*.iٙPeLiJJ|A6`}5tʀ- ְ'](s M5ׄmtii2ZJ؂:F !=S8:0k,l-`.;i &NFgל ~sPU=Rն@Y(SK;} +kP1kJ#Zij=TѶ:{鵣~Tɠ|ȅXG2+W3sbm簱*lf@ΑsJΘX*1c#:\J!8B5첀~X(>p0O烬y< ,=-a2 ۊS锦Į^HǕqTE+6ȑ^JFDa{@t.+!YŌ/L;u =pkpGMa%I/:sLtUzʑop. rx;ilsa'U#]pSBׅ-5SubmNj܊鵤fAo*|]o;r9ŋ"žBE .Rڃ 3㞒5>P:b"M5vy.Q:N!i_#kCo^Y哠qF\%7%Օ`yHNt7ϖ9:߼[LC?Eq:6T02F6<}eHO:g~sXGIQ&\dIx;A?X mCb+_u(љ&.kq} ~Сm)ߛYtW /s4}^r#NvC*=l endstream endobj 23 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F1 552 0 R /F10 499 0 R /F9 493 0 R >> >> /Contents 24 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 24 0 obj << /Filter /FlateDecode /Length 2446 >> stream x\ˎ6 +-(dN]`vEwEm=Hz8I[E:%Q!yH)qqz:ϿOYI篿N^<ןBN_ajQuh4[YkAʙiqgw \a/oRC˛Y?ŭvrY5}_FZO7isB!Ґe22EIoD[ٞ^hiֻv´y2-߆CpC ھ`A]&"7SIHnܺ,OuJW`eQTb R92r:QvҦ+m`EU'\.ZAyzrəL{\q=sɂy4*ifIoybQWn!@c`ElD* Q;N3=}t uAһmDPTHfZd $s` a(b;v  yM#B1w]?Ŕ PP14QuU:jWL JysLшfK1|F%Gq2;-!U0K ,%H&,> I0IDv(Aͬ"I\q !jzi! 5oĤVV^4rfviHZdM1w(^9uZ3n,&o^򕙘vZqY=kiK= #' gJޡWZ| t4\?V[Z$#$pg9V"ix:q5r7x^QQzEf]@{#gN`Uh;lL)+r-@G0!@ sPZ~lG VQ9o_@ U g&B\W@gP\.h4s㚆J})+HH {{ևܩT#@;tkf\ FTs& H@ɶRZ:= JAiJCb$^;fOkrn(JOKBMR %mEUfVy{}[߳Dx9"0^3¦(d5f-˘ڬ*s&]n"  "}EFsY2~Ek>}kGEQ"p#C(W2|yȰ]ZцEWA<, ߞ7Xf'h,d,$;aْ/s[<<{nma?E? 0,휣9S]Ї_c%x˸N@뒄=#҃Eg(wFw9=+)ʨi,iv;0JUEv5q+FdU$. |rq`EENU.:ZH.0~"ZBII3hacp\!:F. 4 E:oՓ- fni\Ů?iKFa֎#%-V_[fF-$ ٔLT$ v@,q{ۄ8z"-gg}h_1*xȨhmB.덪Ymlȸ/^!NJ( j&sHĤFLF1oVSg]F F_$/4fz1=:d> >> /Contents 26 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 26 0 obj << /Filter /FlateDecode /Length 2245 >> stream x[Ɏ6+pz>6@߂܂G/qHG_ kۉKP_@ 8E>"R|Kܡltkܡ^a}C;ݜlBJg,L5lrcIM9*KRR?%QlY쬛wD'e4,𷨃&my$(e];Kd]q8Sd$!QG6VlEwn"N(3AG/VY VP .bg4[61Z}D_y':ߟ̆]ͣs>nn&5ϳ_ /?iho\'X8~0g4Np爀>7 9*NQֶCuIOxWPGј}.=D$E \|(@ö4ħ-=dpM8,՝3K-`P LXq0 c#a霊̴YUG)mR9| y<>%x]h!%:<\F{V> >> /Contents 28 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 28 0 obj << /Filter /FlateDecode /Length 1899 >> stream xZ͎6 )ז@2=܊ފ}C-IvDOX,ɏ\~\}M۷jϥW~}w~q|?O8ۄ5Z+g}[r(ȮF>yAƠG~|OG>hҟ!N7~3:].}ntl$!lp땍^A#HgFCĤ;px/B7FrwF>o ݾ[,+ò1.qFZAg)T&S= E"Hg 9@kYk{݄ c@{_" O (kvO.k?["%֤H/45֠1zYS`1ߝů5($ lէ$U L"Ka{_<(TZ^ÒwʜX Fŵ4'tI(Ǎ:R"Z{i>CUQW\n?8Z E@^9ArFp K)p{.[E/@!Id6snW$f/\t>{hn ..k҅`9by EK" Jv"'&ʃtrl77%.7,mƥm1QIwv=*OqG+4,dM0AlFYatNjyGeSJy֥,kZ6y-" ;rMY$>Vm3brh@)e>>bImȔ'qE;RGC!Qݥ-_ճamڲG b| mFP.(E;+۹4Qn!Gڣ4-;R)ZB*Eŭ2Y:UתX;SlLe `0(j EVN+eK)8Skڅs- dnG+$*KuO3ZKU۴Yv Z.A>؟=N-ALbSwَyT,uLx #9sK"qE\%;pKhMۦhq"v[3vKkّ_~Y3Q -2?ASZFڎ6pSdGYiJr%uxox&3F瀷os2-r|Rc~/Ps:gxYacL[el%H<<0Vv/>0'H.]&_9쳙MPX&w`;7Gh3JBclfx? k!o6̋rF,N LͶ|Eyr2(I 7,LϝTG >bm K=}Ao.IsLغ͆/)@u8bh7pI10qXk.[BUȭ3G+b'P.'R#oƝIP䪢$Z0T;TeLN 4Z&vWgF˖}Ia'ٛs,NIEyE8 > >> /Contents 30 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 30 0 obj << /Filter /FlateDecode /Length 1488 >> stream xYn6 +F,ɒdfWtW_III'Imç~u>B텹ڍĘ|LzyUb\n=0yl[+ ẍm?o>Lm-vDqL;m.8LҙX\{o Vuj<<4ptf5$*`91HF4 q97-YL9IkU=*$yN`$ TimR:rCf@4+8B 9ME)Jeݶ3H7a T 4z^LݡQ謠G~8VhrPrD /{CgLKy[:8h a %`V:' ) -BZf!b(GPG st<;- Dٱ KއR*ɡRΗ-5J-xȬH`0={Ĉ66YVL;T s8S;#*NpGooMJJDf&=7xU MqTN9x[{2Hh-B;^CFoXh9R]s\tL{Lʇ0!+.vYmnRLwd6ɶIh@Y69Js Kw]2ԆdrE[b0rp B]\Np_M/e.'|ʫ+? 5 o&ślFq,eYOZW򱧺aXdylJ;syDա>-104](=70. 9-{g.$b^{ZFm$衅ڵՆ)چ K\y$ogn{o7ARG^EnrO_ [/J!l`4G]r6^> >> /Contents 32 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 32 0 obj << /Filter /FlateDecode /Length 2405 >> stream x[n6)QEPVV.9Bmpq6=n}/ݴM;޿ ߿k۶n6Nz45TDu DLvMӏƧ9 ˻3]߇[߻q=ه/Xrk:KXqU^6jm3qkqy"Q5nۥl۰z2q4+|Ny )@"/@"eR@8(w>Ѥ|.Eҙ,@Ii,smd$>rQU'Ib}?A8XMÎ@ƩiqJ b£$`\<fLҦW+~.D6gPPePQיI~P|Hv5#0R֤o@Nl2$-*_T6< \k[2 'Lc&A|r"Ov7&2n֨$|؎HB:yhi_JtrSٙEÏSM<몹Rӛ4+G0XU DLR%?kW'=n)zX fR~Gq,~.{ ɯ/N^ B=Mr[{RP7m~"܁/"l34j4OK+[׈8\z@= VsB~&0A.O3>*tiuARAp&&]1 /a-1^|QZ|<Ȅ-ծ'^2gv'awwI[5վa=R@V4[2=gKRx$+0jɖFWd9S!5Q+b/*ˉRMv0/Y WMc-:U[na lX Prpa,x {IT x7AVj?b>pǙ0eϑC˖,"If9OMqT.Y]9:" VEF·JfxFa tmST A:D+//Z]E 3UUn1=|KjYY+_ĺЋP)R,}6TeeI:BV 먉U u6V+o^z8=)<q(GǖT'W'%Gp=[$G)"5+Uk&ܻ&z){u,[n(<8GtkU2"0i )vemV~ؑȐ; L[>^@:3&`ʉKzƍ){=ϛ/ rd 5BшjF&5rqJN2 )bv4u/{X.`"Cƾg)܅]*;ɮN2 c$s{JQUe+:Cr䘦8:2H/+{ oTJ!eU͘u@ꎌ'ty)wjFsqDڬ|{ϔlC7K*@ a%BU+nB5/Yy$Euk@yWtݎZnHaؔ]8VZper=3ߎ>VH:5#,sKX\E)3WgA`v$@Qn#Ѿ/(Ìyi{8D16eiMnL<H)tͅ"v)^ ǩ64I9a*&{> >> /Contents 34 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 34 0 obj << /Filter /FlateDecode /Length 2615 >> stream x\n7Wiͥ`#r3[[?Vŭ#15j}Xﷷb헯ꅭj^>i"̲|uu]ϗooa|T`(ێ~I-͢ҢoWf/|sv5aFl%K1nڏ>o_z UB_vg _]wayt>Tw}wlq&?ڶs V95Z">W-FJs<#t ! X#C2sq[V 2A u6L% ~81e@A|_(6bP!GnBu, '}Pö 7WIGd¿TLG-ʏ^ Vc8Ճx.PR0JSDauIo3hiѱ,d5Z뫩kzgvu'J+#Qr&Q_i("%whF4 O>c7`6I&ӈOs ٛwa u#_iLE+$h!aK;D@Z^d o x&U\OwM!{f䄫)Ȟuhn Bć$'+p*T'z4T!uW KFpMS:!BVVL~Bjys*ic1<L[( 94(4P }=J&ѵh|\\ G) ҘE'b" PjKw[eiiJeiJTpN "~IB8(+B/9*G[̏.W ^u cٌ]Ӌbu!%g֧Eܕ#AooFR9E=U='?s%ܯziV/"ൟfZ.ۆC}z_$S OM@ [ |[ )jKDd^]v "?AԨmZPY/Nx cnC9NRJx(ږյ3"E|a)%{wZSlg< ru,[+}AȞ9dz)}G|n~ߟVpV=0 M ?]ՏoX_afobȎ|( y ȸb4شi$7 B#3hY.bj;viZ 7`L ܔx*!*Ssy*GihV2Y_A5Xi?'e&L{wVUtq.UڰL6 &*L^BW:lF;7LZWJs-.D+ \Ig퇭fW GSS88*-U]h^KҺ@:$;1 $@zW0860PHw"^# pUjJgtnJ+f{iX/vLW84UL5"ThyS]a?)ٌe &aoŹCn)44a5Ho°G߻8yk{ o %4k JCZdLeV`ydgNn -i[ Tq*SȀx'qsSY_ŏ cqft[DjPt*GJ$OFI`j% #r1 7G1t{hDq<2fB|CW(;^%%tP!R>7GACO) &{Vm :U1a{Z.T~`}vCՁ*Z'CUYc> >> /Contents 36 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 36 0 obj << /Filter /FlateDecode /Length 1611 >> stream xZˎ6+C) 0`{[`nAnArCD&ElK$Q]lqW˗tbŪvxoB}qf5 ?+?V*7L՚FM˸^NGs~ip ߍ)?,?̛ oVrV,rL7G2sdqH|6Jǹqxޤ˂akKM6چѦvgԌwUE\]F âbeD]0%N^f{s$sX1KVAXXՋ#W&P}I`$G(($"I9C0W9 0|0nc!6K1edHCTx3q6k7UWW`n/@@A'in4יM^Ih! Niz=oTx->8Ka0OdY k?%ecaS\0`+hCq.-2U0ܳ 9b)" EӜϐBf7 z':Vw&| ~J d2qcú@͠P AvUnKk̘PԱYpMH=":hvi2v>s) q)ZP|̳jo"EIG帔DGʑ}krT*LaщriʷD8(7 I u*llSF5NW ~QT~&*sn̪rx ݽte[@|!$\ ?wDBٺ}T ](Z7YzY}x v)2mPimd>D#C&Ĕ  ] ΰil;E ڥ_KAG nxVHĿ==Z t3B!hk(6aL`5P8$:U+RKsn'|%o!uY@i!\L}1%MXMhKd؇ЃM']nWdtY,#䘞u|dCo&@nfs΋G4I>"aﱐg 'v96<3J@U/e1"bZp$\oMg9Դl ^NL 뀻uDهh}(E|  ˫7 s[ P H+MOz .jseFvt&^]Ou89T=Oy(P1}"5Gb( kxlS)q3Cy F%}8mZUz谱ʅ&Ez.P۰K nodsLACoZq:Tl"9O(F7'!"ԡdF35Mب:Z*µq+á>JQ`}/K 6ڗrw_}kWW-d @t endstream endobj 37 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F1 552 0 R /F10 499 0 R /F9 493 0 R >> >> /Contents 38 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 38 0 obj << /Filter /FlateDecode /Length 2362 >> stream x[M&W  HUlv[UU| `*Jag ^_u/_UI;_ !o{d' R}\^ȅ5ˤ7ޕnof{¿ۛݾÿJQ:e,KiecN9;)ݮ`%lJ",jʯ&û$ )fmB1n}ȩ7quF<3*,z zćy4kZύLp+\7*zI.eDW:Ga.ɩ́W@I'JӌU V!-32_SmĖ`}8N~DbY^Nc%!d-NM-vH}tjȡ#"5W\@BSI2G f>góXNYBǵd}{g6j0Ĺ"SOTbl4?`DyJg)8J o2:yڞY}:1[n,cM#'9#ͤ3Dye6Y'Y_PT,^@%6,Fݺt^V^˛Dl[M5wr+˴9 Ÿ@?ƘC{n?j/4RIAR:;QFi߈_4^ Shxyebi`]쨟X(SDlM5+5,kj`Vm`FAc$9fs\SnoANNpSrP"P< mv|10qrwEo3̠}6OzN4"6W8H2tz:6:7qH{GB|ܱ)Ckݬ*YmD͛k:~;ǧ endstream endobj 39 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R >> /XObject << /X2 41 0 R /X3 42 0 R /X4 43 0 R /X5 44 0 R /X6 45 0 R /X7 46 0 R >> >> /Contents 40 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 40 0 obj << /Filter /FlateDecode /Length 491 >> stream xT0 Չ%K@ {{[;E UK{_D/[!C$ot5olB >d>I)/ef{0t(@=wE9@i+߀`9aX}0=#:p&a=9 #eV$tg4 ĝ*x|L db/v_Qr:+ Uʰ΃+={5s dI_ ۟xi↌Wq)jk=-LB,etijո6#LOgCcM=VV-sc;ս񶣳Vy @MK ^&C=9h,nQ!KT%ΰ.u}^;c0/JhǬ?{4L*|_czgi)fN&Kۉ++d endstream endobj 41 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 1022 /Height 282 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 43694 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?+!.,yTP3YxW)W:+_ZOOhox)Ɠs.AK4XƊ㿶b]K/Zx_`; +?gi>2M*OTXҊ㎧b24<}e,cEqo?U/|pJVo*h78?Ti}$~-4X5;+3x= ~/4#$g)5;*+?k=(Γ|RjvTWto7imX5;+/]ONHRƄb N`z떃l?-hκ俲Y|KY(|S(X(=-POã>G U/7; ( ]bxd-#:⛏( 3O h|Su@ú9MP:+sV=|Q}"ާ)Q\#Z9>&ԾQ6J?fuTW+]X$Q)?'k?)_Df=k.q֤:+= UMKíce5DJi]9YQJy&uOV6YcS盖5cnug~[Z IIwj7B~|Q$њӜ hc'[` ҏa gњ㥨ݛ&WCgK-HCzRÕ3\!:.0~~O4A4C,?Ʋfjr?[??{'?Yz7!/q'J<??O*:o5I?B@;@4 OO@:#u4Цu< LfpOh,h:C'?b| .?G!4?#4u;4]<_C0k^-æ@2A$QYtP4\]Jx1_)Gt!0O(,˧_G]NOeBVM&gH]QYe) 8Ǡo΅f'tIt_ YiN:ƙ捏Y:/#0Y:;"9CiF|eU/?e~)C҇M2/SfU>7?˜|y1H c֘ pak~W(C_7 C Cb#µK+al(e?o~(fd1B[} bXڎЏ9~$xs܇ؿR>OoY QmȢfs==?&_&%~ N_ʋ g/ 7@n4t.v~H9Oƀu _AEs3^?z?eȶ?uЫ+e!9Rpcv_:;h6x?º:(X|TG%>,?ºR\,s,? }ahRX ߋ,y(OK] {$\9Nw>%_c_ZKNoF|dD\9Ns+hRlyI+hNw('q﵈ Bb)&F2X9?UPx/l22 f}UScݶlB|uu/5?@4\9Q{N[<=Ht 8Ӭ@cY[|;WE絯<<}R@BP9!'j j3E {U7lnEY@xN>t"ئ$~!,j3A1 ǜ:,r;so03XXF#R:~Rk:8IIapNp\}j%ζM),@:ukodEV$E-!*웥]3aMt|ȴ8gA]XxO %Β'Lm_sgS/ҎfsR"ޛ ӼIr  s'5n\I|/838Q=l4:ӭiD;rr^,jX+9ҚJZ4ޓ4QHG֖\r/sdzqc>UxO1Jb=qtZ@΀Ǵ0oWM(DwhԶ\ӵE V"r19l"Ƴ储ky-%W1$Ǯ;}<[l\*+*.{>ڪ*TT}?Ob 1\]Xޞjq?RXhȪIrɀ܎դd~UAbL;f8P ;@4>Pva#=I>u˟d dfRSGy5jje)$ r^VΚ-xQlh A*s=1L;Kai7X=Ѹln^ T,FAh݌}aVdk "tiX}p?]X^-i] 0?TwFiq!0v4 @@h;P3@@ 3F(4Z浃t5sGg IZ2Xy=zWHzu2(]F# h FIFK =03lDL%tH,[!]Hy l8&O4++dArMP}# (RPwHzFc'@z? jꆝBr?΢n#H2l<H)GJ4 Jg@q}M hG@itW櫕joASLsY"t+u8e$ gߥKr{Ջho- Hdda566IvvCqn} \ ZG 66ل nRs׃G+dO[-`KeakcbV98O=i\V$r~cTb((E @RR)1KE%RbR#עC"FC!r_lwtZj_j9h27!9  ޴NdhZdncd#RP*tlP)(k7./kFAχ/A4/|=u@k;.+F3ϥ+$($95kxyW@YJD dG$+ ^;Amb\gzs{ս4>6vzC5xU\8rX|_JdWֳnakD'_>)Lxm{OSqyI~0;OSHįyndP z $"[txuC[zE LJM2O*Q=Gn SM$Q{k"q'mXZ UR=U{dK&vx=AŠıyH urf_d@Me-`'%b@¦C (E0Դ!I{PFD1*Km-wc,rV61,mi.$xԴ''?KmE<^}u8ivI(@Q-_]OQmWRHjZ;0:Qϩ4ؚEx>bctSM;KyeK{%xZpxsOs/|DG,rvsӽ1- ofo,b!I9=eF8! 9 ($(\j6V&q̐/5Iq6r*Aݏ΀:[Nw^]nC#\еKcTk(坥t N:%mԝ>ax)]S>!qf;kɺb4b?57GmVxaݾ8YK2cz6۠HcHvET=%ɽSJj|Ms*@s]<6F#"AQB n{ء+5h;a1;/SR&͝l$Hdy,V׍+Y<,vLbx!!'ԥ+Z[; [Zn1$ )DJAx`N%oYZV{I%9JP:@ MOS6ữZv]/Nѯ>/\O Eoi^,A SzJm_v NMO΋χzltx$?3V3,nFbN*ueXk<i[Kфaq=?JK)u% <sը_ -4PHlgw K^hjhqp?çun/֯G+>Z%NU Z'V1W.i"o i'-x[f&uLhҺ^_?933Go!YhI,Ot9Z;G&UU$H>N$};Vlw?ϠR'gr}#J֐yyTuH;g,qQG>:z,9dpNs\ؓjyF{N).();'0GjFq掕$'Xr{#Fͳ7w a!ȣVoBN?4B~ȿalqY^ + ̹җW*{u(U]J'U~#4VodE|SZuy1GJ)sH(Q@(T;m&ݹTU 2ǢMek / *c07@^}B4{W)uMq}.(TZoax31\֛o]39@jzihWAUYsLJ N`H#@Up9@Ap}ѶIɍ$*]N-/N|Bڀ-iGjOwipOc>wXXm@λ9`/Iu;8mKllǮi,u;=H9I|pzPi -!_4Y֤HI 衏AJ)l޵qs}rií'ۚ3=:{9G_']1opx=)K ?JV܀#gƆW8Za8YThӅ(QAJS@ŠJ(P(%R(4gk/j_/kFѝQi?BOȻ׬_YsLXZF/ytUkx?[WCI*6R A*^ww!$ h`q5o{]U/uK-97^]CxV"w':aa TxB$OqFr>ޣ,X66峆'Fo#{a,r`z?XJ = `G?\؇ۿ_iCSZ W?{GGX&ÌycOլK-F1%3n 3PѴYWpmב5+YrAh TgIDLKR۶Uˏzu?b?j^VG&ܒ>+yA}ozZ6{g^;\+%.\:݆{*LOV {-=QoL81n3=tLo.XPw 6"wtl̫#N@ErZ ': hDT;2'QTσvV< }֑TS~S"2G:P>ҭpEf:@$g}OhmF>Kt3p瞜Rq84G;ck 郚Rq5*QOrH>E@ TdӞI{kb]2(f@^MBbgAQRiQs;NNzPG?GQ}k*Gq'8<JBB@=)G^8s4y0'1Y݆{y?[~ @2>jdCW@GqYvM&? +'Tԃ~OAn53ΝRt@&is709 "-|͠&6ǽh^ז0vaFW֮Xy7O9"j+-&LR,!=J OZ4uMn8m& ۙe@T=rjX}]XZ+-7g<`?-+̖_]y1=szmN$!c!AN8kk;K{aMKSrHLrxH-FX^}GOXMi# c#EnϠ\v-komNz+ H-VХ 'e 5'j;W#'x+2k4]@$ڶh`$wXZ\̒k G]О島F,)/_z.1I"Xӭ䘅ᰊ?B +[(P̲A31Ƭ}kSA'wF!IQ]2 H=i/Ygvy?}}1۞&m5=bi;K[)Kld.du&H,2-=| ʜmị:íiW\Z=[ȉ`]U6ڴ</5&2M%ȉ&ڃ]DDYJrFX98&JB9̿<;V`$*plƬ_MK'PDdIivw‡"M)-= .})s뎾ϿZQcP9?4NNs@sژ z3lw>~IƱΟE(-'zZ ((< %f4I(A4w'(4@4(4-g:{IЪ^&|9"ޙ^"fxsE3cEi CNj3+\Ut=2QE!GJZN1@Q@Š(4VfǬYٌsdէI@'5m-%YU?wMҖVyo$e`9b;"!9FiKgMRֵ] I?‘v1--uR&ExA`AVMCU>O[UeΩm@jnvmZ݃VȊ&oE^"#֝ _\'܌ףUK=2ɋAV<SaE(Sɴ"<qނ@DDv'‘dEt`*A"wj9b2DHIhzcvI`p:>U{f5-Z{ٙ,)BG -"Y$[I ȱ(8s\nCd=}d.navNM5I6wH& q׬p9[pKͼsDwG*SȠG2)a|3=7ӿ(cPkqFc3 ;l?oijo/Aū>t0۠8pD1gݿ¦Sw.?'5ɄwLr[œtwaŪۏct6?Ճi^ sa~e%ߘ𮫠6d?B:P\?Cj=zKl}WAk{m9??J(=i? =A?ZҴ>m28c?+c#ێ4bOiֺ³@yGwRyN9lW5kcӵ=oKX.xL9d[pRA"~b"Q7}qq*IԛH^2GzV-=zX-Ԣ12<2HzWb$k"28`ROWmx#OS#3ЊgڹInA(naoIH+ZiٍR6qҕ zPzڻ?C@#t?:\Iހ(a}qAG~O«H=qʫIX턹K\OJEy2擐 ?T y5m'bO y?zR ?Lґ@xl{?j;@<`t9ƙOZ9|2s-fEtu?xh|?tH(GZJC )qI3@bޒ?}TIJ :\k'KC>mGO*D-ܷS?N{Ox -Zm=OƵw-EuOW(nXvwPI,.rI\endJ Uء܊H zR7{E^EVdgKh{խִh=(mqBHH)# 5aهqb'27lzU=ǿ犴Re |9m*I?ut<bOw82Ñby>$:g?Zp@:Uk洞_vJ|@ǰg%:E{xҺTw[)T) XIY#`2AMN-zy2Y@a}?nc[ʒM(\Go#A+DuÀLcQl#.;sJ&ۏi9=1sT=ӧ?W27ddX[u Mrb MBsRq׶?Zc 5Jk9!g=hՌǜU`sz*cNR@x9_UN.qDFU($zz}j+oEl.2q^Kދ2UZєON?ZJ#* "1I~JF=)t>_Jv~^: j՞n~ȭk{\|hN2}g{E梖VIP2h@rΔ1'=G̤D4S!+RhdY#qe9S)M7KEސ-%-0ih4cZCEVB%0.I=YIS~GiS42h*QܜcR8` R'sǩAq㚑"gT۪y?L+)UCb$GjN(X6m\f;ְ|E0}{C*R{?hKsicIn׵0-UCXlo v}1Vr3HRS#i$H3\8 4Z\H L#QUrԅ=8Hs.hZw:iI@QހS6@!@z:Mpҩ%w@|)"^^!"p+f|Vvc?L?0+=+φ>c4HLҊLqU/(tO0|cb;(>Ҭ8% rJ3-h`xcJf'QF9CB]ҭ|Ӑ'M::tW K=iAwj7͔tvA7z[u#Ȍ<))=qOXCk2~I9>Og}kLFGB*220FGP N2sZKF G9*2+ Do8VNVиSW7UcScKgp#$]%xܣuSVىH `(J}`Y!W(j̨Z Vx9VwwȠU{믱d۸fgqeOj\+7Ba-.(H z܎fgڢqVVe$ջ~s70WhyldݻۍܬJ:SIrgROm (!U#JݝVvV>ӄ$kڀ('3ŭý*3ϥWM>K8_` O9+RH暮)H#;9w?]|AdTz|Q{_0#hD7j6q]ZWrSa3xC I /hs>c޻:h6xLŧψ'qHLwVVgG "JZ4Rw.dJG' :F8PvF>W5~Xd\`Vꪱ3cδo#ԶȒ1˂#A0h5f5ԥ &wIRIFN@#֯tF{V˧A{Fٟ_)t QdMZ1P{W83MuʐxW=Z1i*5)-~Fɂ4ҌΣN-EqWt5h\Dq3=s4h3T"7w)Aik _F~2'J2xwїdz \LͲ8uc{RkӤ-w,u$l 6`adc@A? Mfuog6ؑViʔGLmv6Jc?v2~>IjsZ\MLs\];KpM؈Tu$34Ҥk$R1&kv9oq榳ṗȕ&cqUEowRC5sc{ɜU>ScxV ؂9MKT#ڵWpup=73C_k |L9{?DOa f6xe}q*ݠh/p{ Guf^VSm @+._in/d1meb+ZmoiUjg-e(3Z7]\ gٹi<ZE?Tsϝ)2?5Wb*SS?bOi]eŲൄ &84I$~rzn IMY v.=pNqWRqKq9) {>Y:sF*MIGJ+&J\RH%;bR|9s "D#_1I`B=Zoe죴G]BMvq0UAȮ! sZc&gs@ s=* { ,c}洦%6q4 ơW%2iآp\F֚.mJK2@+~ "N⸾/av[ n]2T`imsy R[B˂A9{te++tN]6DJɅ*mAq BKyRXFF +HL!E.#M5jˀc${Bө,4P*M;rߝOgh&^ky;m- X-GRUf2(UĞ֩+7q# anEdfAPcڴb9r >}ZHY`e1J}>ZllYVY_X牣qV{NV[Kx rv f*/QGAv򴄂J g܎պp= m6.H e0//C-)ZV$'0xښMg&t^"V a 6F4>6C\AB?Y*~SXeiiI|s^6M'@]5ÿ\y4t5QNCc *?'uv 2I<\ׁ#/K~ UH|=c.&YO\+V `mhG]LQ45_O-dVl 0ЭЊx|v\=vNI5=!a5,u&̌\g]Lnoʧ5*c.f9G+M`W/br1_nN* -5 X tS3z鰶Y$20i cqYVwwjbݭzenH Q' j2#lY]D6W9 ?.l&W*0;o<;d{B2FN@I;Q9pf*˚3{Tv,.Gp8q޾6LzQNM(6SŽ \¹Z. S-,BHO$MbpvJ+[G.1d[4#PHh D=O?hcKBiNM\4uvnZKW6vD%Fт`;V B*Xi"igqvd~b9%i7+1 2v;ª#{tz5P`i(S%AF1n&4Z.mm dD\{gwmc %fI8PҎZĚ=x{[r'N-n'aç!-%vi)hgl X`]Z& (n٭sEbQG֓uS'VI7!|Ү54dsӸd?]0nښ@sҒ=i\UYG:\{Ҭc$GqᕙaW*$+FKKqtn또"ϡfx~@?b.<{խc [{9Mv 39W[A<>hhIe;O2~a~}j ؓbX*{ ukbfsp=zjw }[3j OV(Š3Es+zn!6丄7Q\ h31ɱW+̼_okyaoUV( ZB|k=s팙*Y{~]wo[n XZQ[YF/z~"KЁsqXNR55J %;KPr'''d)6zw^8}=~=)|_pچy?N|qyH?o ´.}ӭXZ֠.D3{5_+*1vF֪ܕKrGQ}pW8PvXThҝ6gеEbZ/"TePմ"E; "\<||򫞽;vXEIsI-VkH_2HfU#?PpzgeZO4ֱ_h!T SC~.yțAX;}E[3$+"BYv6t8d>@ EeCf:E. ̸"$9'PϽ2 7mqJE++_hF:>j+P{x ^^v[kG٥XN[Tg\2a#޲i_qU#Ei'0̭ߊUආo qrB(rkhɥ}s\Cn*F`2}++V_i(2/Ik_6s/F7exP 1I(,5;`+=7r2;՛m*n%)򧷺v(@<5tk{]:4^\ ctzƾy}Z7@]J`AqAHFztVd[s@SkqåRb#֓Ғ1h\l.hF(0 J)J-qc:Dd@"ۛxnx.bIbqA⹓+-o jOdYW̅ڨ>׵6G){iVe5NDp&]kUk ׯ֥՘ӶAY6mʦm8z8l~Vњ^-81nX'9=ɭK)đ' Stu4Z+c)GJ){Pڊ;ByE&xE!MVW "GI ~izQUoT 1}L"̠{uOm2F$e={Oc|[4!ETP}FUʌzM%7i|,@ ߥY~ndXїq],=@]ۙD^|^a ;fI@ :Ҏ4f4vIFhvr–̕'9^+4+0¶G`*bxFm. +Fi]CVdP j}3W2ʫ ܅F `$ :5^-YhL))G4hH -3UCCZi]ˣig,6"c ̗_k1r/rB"Ro߸Ȫю[7طiz9>JAՅl|Ї2nVݓ>m826ƧslE 8ǩc7:Q s۷R줊K9j,qNAVȦaq:Iگ8e's??'X6&dںCUG%?Ϧt⹏qOO(tr(QEGUlXC2?$H󏡫xkb77U`ps?Ҁ/k)-E.+u 'RY[cEHB ˃'^x_¶ژb9'z H~#$I,U0ᶐ=3}MjwbygiX~6It՝]"4>A9ڸf_sZ54XMrcUR:kD:5Xg,GP ؚ alVwbd𭬲ff- k5Sj(Dʾy" I^3$d~FKZ;F1kJ0I'ʠR88 [68zdk,@2ƍ+SOcPH=}=ΛA5s;RQݖCt-uRQzn{sJm'_#JTj!v r2OrjmƮPIon"r̮ˌb4X%E.FyA F;zw+˳GsW#98*}AU;YKq~ `Z*@1Rc,\Dp7& ~5nA#IJd14FM J䙤5V;f@F.]%i*R"v\_LrVjrz]m/՘($܌q{oisy$NܬYGPn CMsi2chnf!E\B2 5CpN%0znƄPJ;ee6 ɍ"iB’4'<TeehܡP P@#k]%x1 ;g5H&yB7E*kY]fJbE-Vw5LE$Vp[O4FnBݓ 瞞5%0oMֹU!՘W;-4L#3C(JⶂUi,e\g,TG:^Tqn`$YVp;wlZkiq1iR};M)o֔\ʑ mi[p1NW7͡IbmvZHqPx}@_볉T!A)#,杴Ǽ׎' N ?,?ץv:VcZ{ t>':kk3M"6 nZT+Gc=:>-\,hQQ.7O9 8aIrU Ui-YLu%tbgtOPňk}Z:֍]XpdU["W}T?:FRadZ-l}lXLǡꮺ%pYNA_Ye59k/xj<_mӭn+ܯV>G^RA$ xvA+`?ZVe8[Rzظ=J$qKǯr?NxQrsj?!y;@Hf򦟘ySm?pG$zP>"dB T_+] F:q4e9׊~*zgV 8?=feq+&8#<:)1Zԥ{d s"oAj#$"dd] .Obq\*y21?֐NqVbˬ uZH)p'RĂ3U(²%9SzFtȧ+2:T+۹Ͽp5$iB#42d`?SU-ՌۈFo?ogxCm{OgIGֵ9|&4͖8 q$[BIN*]Ÿu*nu5e*\FqaIAi pIG@dc*],-&Dv}jM;H u#dI y702}}kCӊFV|;@8БO–^1i>l|`Y&waso$"Vps2EeIuk[i NBn2`@(ց}[O=~5hݏFjBRI- oT+V 8Z+lnn K{c -Aܯ~#IҤKwnlJ).c' |먦#O̟ͳM,AX +UcOqu% 2#qSu략c&{o'& ]H$!=g&Q%_TIaO 3tԇ@Fq9]"$0(Su'#ZI,"TNJy+2~ɤ1)E&h;)hIK(KUo!3`v>Mr2[PfP&3l rr+Skva{aIhZsnAȥM:TݐGn}mv5wַ^\6ǎMZ"wjPi1پzн) &w@[ͷW;sjf8dXaÑ}i@ERX6.V(~k@B')E)w2$^{{X~q`+$0]}fj4ZdZM[{ K.[]Ew M\jZehcbã(ouQ$;ˑcJpQ.RV|s/WK\?ޓC5r_?H>_O\/ҏDbM]7j(Q@繕"Y 䦺|a*,\::}TX -zX:?\n\zV>cDmt+cCY9y5jN-V%:SV+Yƅ | <^]FO >c5so&ēd{LRt>ƍEA {hʤ<2ʨMt9.>a@BC/B3^[?<+9H*F )Mݻ->tfUGR‚8T M_F4]$B`O?׹ ȖJ;i$o2SWl{7rr2k1(7e7rW@'4,N7\Ω7wkxÀ2W`ڄ+/OƙKokmrs}kY+#=H0JT'*؄26zңxK `*$ﰛ%#b)4D&v*%թ!yNDh9$Uu-d3eնZpR;?ɻ v%f[UO~A@d}?O#۰S_?\`d6q%4kҡg V|4mݕFBrCA?bz~}]*h=鲪4LQ&e+-,1[e@ 8w7l5ȃY]qX?kQ-[:΍G.fH8<R84{ 1X$og]qr{sVeBZX$QXyr6$X)5ۛ4E\['VR>~DY/n/;CܯwS UShcesܖڮ[ROL{R3L7SOM;;Ѱx#n"~uW;]q|0qv>bL?C4XztN)5ua eJ0rx3'f2qù󪤃yU)r s!߁2.rqkT\m" dnjH&ӥMS$Jg'hm#IINqON>Ncv ϧ?ړ'~&1oנavE'׃S:^Cd烟ڐ}?@ FjqgO_OT }W";1]XW3ӧC$'$y#^ܞ:jj猜^'\.(G!Vr@#"Ut\ %6USVhmrpZVPAʖ՘tP *sr%sF*d$Zg#>VX):f*6)L9{PW|)|9#.RY.A:ȍхCD(K^>ƙҒM;Ysӏ¢b2Mh>e:QwJs@nOV$W", >O!llzUQۧRRHy朳Tcw>c֟*;"eju=Q @bҋ%]{jHcM\Y`UWKTݐ" Nm;VL tK}5fy1 )@u'-/{OGPұ?Ҟ2#s 4V??}kTTa@:B(z"B=W+'R/#Gs2DNOJw94$(뽆8'OJ&`O+ss [_&^º^mՇ{q]/|/M^95B:u,d󵺖)ZevW~[kЯ{ `?15T`樨bF2rzVF(¶3YJa{JQQMIMAlzSVfEv缺Vq-Vm"Onʎ^/#QkkZ\;X#}`Mq E{md vrQ =d:=}+JOcq1^z0V2 w-!X-dKqSf,b\Pw;FP--&&D@qڝQ dC3D>_ŦQMWY2A) 8aU-{y㎑\VWSԒ“)W}cYeHStxӔFAk$enS [3r]c4QT;Yd(،Tu|Gqϫ]Co%ut~@ R9I|}Kj0CxkH .#v8SIy;Iwi!el:<)K+ׁ`Lci0j9UKPGm6໙#"[tlyZ|vǨQX)~2?$*-%SQU4v3JcT0wqUJ{nh֨r9ޡݜGJH0 cQԚ3z`Ls"Ua>Ssoj֤H]̋> F%YKKG$mC$& ֵrA+CN7q f($g ::tևR^,n$pIsZ7ӽs[E$wfOxP"8נt oI\y'Aɮ&k@xt_H,Fz9;8ݟ_RRv)><8ޗa#WrD%"zP c4A&鎙X_ATaR.ZԵv1O:t=)E^zQn#@##!I􀓞izUbGZ# xTV'hSJ^c՘>(XʧDg`zN4-dPQҌRoJZZJ.8sHi@!RmcHv(+Ĥ=iؤc6!?Ju!sRP{H_*=%]IG) (I4l>DdD,#=!q$c>?RؙES (PEP05HotfK0']5Uu+o6Ã,l84-6 P0 %ȦKP~cv156HY..'r+B3i0dMqw7zymb>c޵4x,}*O?'(kcWAzЋщ^T-8 MDTU)s3f(;8YC0 {닋RrVOJ:ͅCrLaG˷:qR%gVc׃ fЪLv]) gt}J]k B":TƎn(n/.Si$ǯ]tY$* e=/H-,XZ#Ʊ-XerNOqZ+Ba`T$H<5<9oH]`zgMnVVMt 0E1@W#6msmpPȑ̀uی|J֭c޼!v\Dp`np.n--?#ա||+洌{ݓh" ^_Y R4\9fͤG'Q SM0!wEEkwuK;ֲo%5}ZY%N!ъsj%'Ekt%N8|W#4[Khl7O~KqY#|s[bScwѠy'] l-TDÌOz4EW(0o\(j 2j[bW\ċKhBjD6.ݍ{]>gv3h߷{2p%6FE֜hhlC]RX|zOTfTdћa]kt=ڡco\zVJ汒ne*:6e~jp\=de/4p"OLdL9R;iʁq:Ni\JNgHoccH`q=+b:G$h*$\>s-9˻(<=F{{pd\Go[yy0cnݎҥ٭ WtQ>#)'#TRZ1wPQ{ Ӻ$$(x="Oo߁<{q~b?v<{sIjQL#"}iqy2JQK0819Q(FF>v=I$~0I ,SpdlB2ɦ: qk~ӫXߙ6{p'ij hP[$gs#RDž4/o{)$6>R71cbդwad$n$ǍӌV֙&qH({Gy56*{&Y跚e1xImfoj=Oۚ(^+7W մ6+ r֞:@ N~41.88[zQ?”HCSG9#֜Œj[9Rm-;qbU~Vnb-J:T9ɓ'*)' ŋNN=i9n5,=GNbCc U^⦶sո$HE(@(wS@ EP((PHE-!,&)~)ԆG7}P=+[ WUV#3۴9*3b-2_T"Eb3D%X$aG҉!Pʑ)8ƙQES<"wl8zS5Z->1'2Ǡ4˨^v $iHj U u=O҆TUcZt4p!6tP8Kǿ?Q]y;DέM_Ry6R=SSio AWiB-e)92op*WѦ5-ZkYA;X]Iߺ/! d`qޱ95)mgR!iEܜ{zkqu-jW-4ۙqȓiãz}MAcHʖ)#"Hc'}ziWKqt[D؍#ԍstt7A]ĞM;q44vESAXkƒ"2#ҡ, ;h`  \UcjdoK<kg`M @3k'Ylf]g ߥg˫jz-D W_jizL!\wHXJb3k$XmOK v8#~mmaK{h(UTpME!5Didצ#!hܒ@=O_aKjTH ӉU!G<@Q]Dq 2,eaAXMXGS4嶺_614skVЯ/DWq[_D6ȾǞj}qt+0\lЫ|#]cXݳό:@z e4E2~j_mU;?ٷZ3m HK{sf%\s3[Zx?l,Wl}_,1h%LjQb(gڕ沃OHr=h768@Ҵ–/ Py)FxE_Ҷ5D @` uQxJh(L1\zR-V ( }AAxI143gѲzB=eE^TFB…}E'/s AJz9Ϯ+: Mo"w1oN# q9(ӑy02=y9&ys.dE8S-Tj]H9"N'f(U"Ù08p(O#֣8=ZiR`G^⎇ןNi{P9ZN{~Q)s1ǹ=UYjVڔH8lz ZUɱmF)h!`u_#$:_Jc=)9jP`ּDd Y!'$+h ZJZLQE-bEQEI@ HzRAeO?SkdDֵ46ğVg|֖Ηi\S 8$yyNc9Lj5y^ZCw;; -#{W'ey{<'m31WaТ oc Ay% ǸTK++hfX x9A=:ոbX4}..%7 -t=B0jGdeI$۱I&uqG]"$4Eah"^X֯/ ʶSszk;E҆`m4#$`1''hRzվ{2.>{q3쵧Mv)t[qڴcv H]D9jr˧X&֗tmFsMav^% ~RH1·~ ewIP˾[6C),x$_u:}_,V*p2@횡݈㴉c27" vgq Yrm=I漬&mN*ƒQ|){?t{m;q]:MV(I/sC>ox&@]lՙ1U*:Se8T4KBu ), ?7~Ց}K< Aiu|=%y2) }Y2 | JGn=Z*09:N{/swNɲ0`HSNA2iډDCFqjފ;ъd2bPm†jS6RQT1h4Qށ KhQGj(4Rv%-7O"Tj''tL{VQ ڪ2RW@jNV+rA'_zU*)-Iy1ަiOt"Gi=)ʃ,SKM56GVSk- ֗28n,i zRw׺{sv20V%jtߴSL%VQi;AH$'dqEpl{OnZVOkF)N./cSR5ЃRn`ꧡ#~6p +4k fl([Q\m灵-0y%aNV? GΟ1˦kãv?O-vKKa-q?|רۙL zf~d&in}k|0/.RdZg+* _t*0mi})Չ=gjOT+(C]evH2=+d{ 4;[VE;ͫ\P~n Bʭo?!9N*Sʽah$W;N s-Kug k{C4ERA e$xB0S(haS:JJNil&z믴 4gGHͦdrPZ8Hڠy9E#ͽnЮʹ !s=Mq-3{+/ NX}dGEa_}k\es7Smt pznR'[q lCu\.3*smi<28}VطtON6q s֍\r?ɵ∊L\㝹JbѯQA} C<ǫZMuhl n1?ysީ\h7k5ů١DmFrKs$ķu%=`4([w*{ 0 @k2 lKm|#MmԽK9篶qXcvkƀ*( >B@Y\4GR6|c!9\8q*Ŧ4,7x *ѹJkfh?1QS'u\XEXd}) r:;(%:gkn 1%tl1y?A`$.o,CAYT&gA }HQz`e[xlNrck| S' IdHԳ`p=O5Xjol0ufFbE$t绽L5MbIq>ޭ"Lc*\QP=~4q =̑v9PsZuCjv=E.e\nW8Um[V<,y'ZS[Y3-8NK1=yP"270:/Sku3_Ap at8 sס5ip[Y,7n$2TIP~R}2R;Kޒ9(QEhQENK-"e<:Zޓ89[ٓ%}6-ݱܧU=kDGCT~.n9 R(-c1ڀ8MXJkT,HJg:UNdʹQ djz׍mD"ЉmFp#ƺz{k圐 L> {sBbeeRY"$20 +y!o([%ft``]2r0ǂx:qWg(N{S5Wp$>eMKC ((j&Aj(2Q\ƣD?2\ۑ4~UQ{>]$iW5%Xg$HI9ziY:LJtn?tdOL5aAkaM F2Op;3Ҡ-2)m༁f%:0 Թ2j~>e{G-޺K/UUH# \usKӪq<,sy`vǧv9ZNgح݌HۃЎƠnDeM&݂` OH T <қ=?)mLV ת";mc\WK!Lg*y뜊3_92s(nw3;鶴 E7dP@!}hNFV*j4e{,'~vT*~?; rfΘɭQO SP:WǍNe r>-nӮH9ec'z*Nꢳ;;o⺶}ʡ}YߖgMqkZ]YXiaml2Ǩ?w Es(3o%%*@%cJWOK ^Nӏ QR7z.wl@<o"76rR:ŸN1L\!q DެbJ!JZ8ق! qF@GzAȠHP8%-֒) "Hy/4P9-k_WSVAX jjxFJj?i{ R&hZgzq؉h JZJ(=3Yz3\MϪ'?25.3ŦJM1GPvg?cx= LFۋ[X9*:f]Ht?'CR{mwy?]j 4?j6ZL:bG0f rjߌ[cus%Q$FHֱ:\SUӡGh'Yw1=Ǿ*5\w#=>ƹ>2$K@Q#8iOLM/DS=Qŏm齙~PGr*;43s?E ;$FE1 Sk rB0ש `A;WgKMꘘvgKp#xcv( VC4ƛ^b D ҦE- (i)hz:@qKGހ֗4PE'Z^(3Erz̧^2G Lb'vr2980:`R$f\վƩIcF=y8mH 8< I1 ar2:Tsj~H^I >d)wI̛\t(OnJn3ЌfI#t4Y3=o}(x4RO˵2<"8Hw=zW`Z6\_m29nfXS/L~Rg}Xkp^3֙({3;͍E`s)#0Ҷ?回G?s$wcg2-.l,y=ap8gL2=fX?z㎝=+xP> Üh卄ټYȒeūn"#1yVip?dj'IMoyV|\)vHV'i9~:z:\ĶYa dJ*I1;YF?zx$(G꧱jz(@tLڌd,dr֕* ņ?''^uJ8;{җ %M7scg_h2@Ep¾G*=GֺFOL m.dKIH?yUH. K9]DBJTIN;j( |=g0J5>49f,v4O X&sQiz.!D!Y2m 1Rr9K4<WQHz: c 1JzPh-\toLR\GVRYm1E{ J.u=.@>d~29C\VLѭ)J]v8++ۋ6f;9Go&Is*''8?JD~=o3K:'#Ha~]`uJ19-Q҈6֥aOv$M :1_c_\MoaLoc]B}ڣwz;wu }{!)G={W(o,0|ׂW#}9<{'[ inchUV p1D..$FUKc$_U VSΆ96|֒7FɎMbuΈ ?3ݺun&)(2#3>rZeIw=LEJ)J !GF@9Gz5ڨ?zkjO'(y~ksC-~X#)*AyvF\ ~n hy54j8`5E|"+ ;>2,ǞyӅuFWW=Aҫ"*@ mUտ&tr?VM;nge±(8t̿nmw9$4H=:sV"H8>HSS[ kQV9\t-SLoJ[!t "ak<}*k2pkiSIhhdZhYn\`ZpX~֦Vj?zaQ"d)G'qJ{:>8U#UҊ%-M!;(=hM4vh CJ)ZLuHz`suzSI\߆;OJd endstream endobj 42 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 1022 /Height 282 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 39871 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ? S.zG>뀭G:&F| A\r6袊KUcK(# pNO<ɹ+q 8ɂIOlA*VS];CȚys"Cl'$zӡMժI :$k"(AKxַF3- i ubx~GEv-[eX=szVJ25KT0^Щʌ玟ZM']uW"A]^m[ 0ʊ²n)i%9DӁ+{:i?ҹpJ=:zϽќ}NzÊ_{ZQgԏC;vzSq}ijK]z9ybt8@ jdB'!`mݷocִĺdB(Bф.I#Zmnr%DdSuS MGZ[lᶚU"znbHW#kW:0ky q * ~t:Z2PV=6rǽjw3ZI S@A\7ߍzX*げpBxŒR9;IAIAou.GU?ҬԦA4"d9F t8Xs}[@2搥*n]€cw|U4=>TPE*̽rx{f!$2,z2qjl&8 ТD;7cZ,6>dGNbG`z΍u\̂qdIƄZ7UD $z}pk]5 kwuWPi`s'vЃfڤ)HKԯW[q1~X8\WKN^sGj.c9gO+k[AkrqPZC}k%bHe]R ⢞_kr.;b[c'WddPA*++}BKkXdeniKU.#69@~v6>9^`8lgֹKKhZFcͷ8ݏ_FDWt#qq$6'[qCcRޓ\t !exbkWz~4Hu][ש<+'QQỷS\=#G.txϛZ0g^jtVz}R -ZYH响3Fy+, FIw/$YS Ɩ5} %;o nŤKDVI<>Ǧ Ub;u#epj4gs֤2cv`l2HXʸڸbXibkx9g'һczҳ]2=N#Rz}+/#jr̝70KW2$2(=8Z}zod{]*vzt=2;W՝F6nE6C j5th 7y>n,+q$Üu}kOSoZh8Յ0y=#;u┌9(aדHә08Tr6'<Glѓێi@Cj5a`W;c&<ьe w3ԕb($1;U#UQKI@ŽԴPb -&() - (IK@Q@PRSI@^x x8+w@Ğ"5D^fʰ|A𞝏Mt3H=T*K*[ В~Ub$lVs4SHQFB /Iq[NK)R}R2znl`g#+\P.e"#qdon.n3) 3\@O^J$zOp!빙Q]LOOR蜄/qWc)LdQ],޿^} >t}Crwrmr }rJdc$ɝ @>iJ7V*2qm*=Aꣷ~G\vNYGjlÍ$gָeM֍Ec?Nl,=\SpP0$~fD88)rAbIqqƦT={BiGH0OCv\d9O'Nv>>QRczBOՓ+S?bhR~T[uI(+TbaH1Zl,^Wg `bhTdfO*֪7+sn0 pJgL]:-$W3Q ᚒN偣jHHV7(9م>9&)S:Vj}7,Pt}oMAW+cn=_=): 9 9C Kt;8KQ PL.f\0(</vzz&CkjXeCgzx/6{!([0͝*T"[dpziI- DrvW>|r# )#֩DmuZXwܧ>W4׾ 5Dd'2[_Qq}rKk,pHBɌ8Ŗ4OYÉؑH>Rz u:nmXwg x>,VCWPNB VddͰLm7Jn"\`?Q+-d Q v2 Ay8SAIsZ_^G 2DĐgchnXĉT`r)!,2$ʺAQ\Cdֵ.|OO?c}A=}sB"{񚹌ufjޤan wہ:mDR29gՁ(s֓4wx֥uId`Np u2y6!a oX\m;dԦrw]u [g|/D.ƶgѵop@bqQϙBh^ '_ ]ט-e0;1)gPҤMRCe&dޣ%Fg_6,[ %*£qqQ._<,pW󞟅u3%%;7N~Zgf692 8#ׯ^ֱ5۩m$fJ͎SQ[I"&Cb]n+s]D) 9 7zt)>(,K!OTH7ʬ薳 Hs#Kݕ%wԂ vgє9#m㸥2 d)ZV910Cրs(,Z %)i{@i)ih(@(b ZJ(w>1GozZLPcҖb Z1@F(:R@ Z(E2XĨTi(kqj(-%A$;lazz2M F\U[uLCg5r@)RP X(QEwc$"SjoңY"6As)z} X# I5%a^a6 B=zheLn~e*N0#E).ѿRT3$DêvoLrF {UwfLc]HC+ FA]gS?f|'9o΃֚cN-xT 5)2{u ֳqebF /X¶&ʻ0zeʢZ@ Ufcdt;#.iwɪ7ZzbSrzg֕ZJz>]dĮ;? ˆvlLf=I#"2'wb)?ʘpԡR5j]VHzdޯEV-p?/Oo FR'BJ})8A,Z9e 4 ӱ \}hL[D]OY>vn}'[v`Ҭ v.Z^Ѻ:b.uбh3pp"VuuA6g tF J|K(溓\76u _kؖKBZ{w%ͧb@qq:3vZY[,q@=}OYçڥܓܟZ9ˌlV/IJۤHW30Qαn,}Bt)6X,p8_tۭE,XgIW NdΟ}{q> ɺuf{k` Bz5%Eztq\r>b8+Ƌ mrpOkl;zor {[X`-W[\χOcWŠ3)RQڀ -ՑyXQZmMjDξUqz lK$jZpQ&N5kI`žF 20ޔ˄̰) h<ǰmrQd~CcVNZeWcا580(#wOR_ޤqnޣZ%UV׌d`gִU$ʄ%:.\*l #B=jp>G#ҶeIEך+-{-a=TJ֊T0tc5-yӔ>$IP:Qި1Gz(h4(:R(4b׊;њ\RPRP(@4fҎ恎ԝ)EZ; !4sm*$_”K@oM hiJepx5- \RR `RoEZ2zJiK4AQr%hPH[ݤA25-+c)v~YОe`AWNrQ U*'̮WI$ɵqRK}d=@ZsץO#vʜ_.KF-/xZH<ԖCf=+JqT?;,\pi6P3DOW%,ry=A)NNv|[+9U\ȤB5-(*ǯR R=fM*i;&Ct-c7)o5dg'Z^)1t ulsr#lhnFֺگuh(W}*dj\W:ԐHt-Nl7ϨmjY'+y #W/]dh`V@+5aD㎣֏SZJҎ.j:S8$KՍf6*ë{ԚOo=Y<ܬZHSNkO? 8@zNO\~ïhA{hvTv#9(#4jVZJ aX$WTS4iW@[϶+<7b-YD789o$kKM  ֔ 3DGb3\w,&6'tBwњWЅ2֫0ǫ5Cue캜 nt4{*J)wOi/6Bʑ7nMdYyy2UhRCsۜUrdVRu,qBvF9fh)D 9`ï.v&:`q/ BVl-GMͺcW\j^}^\-ڻr?hL$>kn}ҵUԆxZo0 Pڠм7ťܑ^qֱuIbuo+Lvm6 F_h\'\Y[h؃@$T~#Oޣ?TsUV-̷Ec##4^` Ũ[)jBP}$)b뚂mucX*BAl ‚SH4].| r8~T֎DִԌ̌.#AQ$.y~tI4xu(W͎V3کiMFYxEiQY әź3^gɔHO ]p {MCwm(!B?5r=_t#"(>C|֍j+0 +7)]+0L?Hqӏ|?joخ"&8e>ͲdXXNSX1A פGG ϷPl8 t==HzN4z`~iv[bC{V>37w5}+~AKJ^+Q^{Q@ @@b4w C@ (QQE! ;Ab.hipݳMBЃOE+kqE0 (4P1hUIc:@PHhV)dc@" 5sַ/:ZԚ0$EiC$ğUY4Ԭq ![w#HluluS҉6' 1s{;qUyBd a֬i;SnAU!y`ɗ,?5iP!;NO*[3qdS[8îOqUu.21̬C ܣ)20R0sڡ7䴈$Y.$0i!o%sa}1^6\̳Bx TJ<-Jr"ѥIGz14 Hakt}ቖs̖_ñ~⓭00t/kxRSUQ[՝h:ni+(~koCy$(K>na 7\էakA.tz,qtt0\EpH%IQ20 "XJrF*zUoo Fitd#oN*ϸ際v:Rn88)F\0Ķ;{zҎcOyҋNM5tiY\cu\XQfI!.N螊Lև; :NSaEpn NK4,&b17=hmΘWJjÏ鵊w)4BD 1>Zj^DG (#P}$8ju , lڎWypH*zQ(gR۹OXf/<֦ӓ˰G7Yv HO[ 6AzE#Y{]GQRd4/j))3-vbRE (4?Ajkn׿ܷZ W+.?UWU\?t:d$1,ǠjVx2dbg7[ZtWK K$T wSpq0Af`޹\}]j tE-b.x kCE yAS49ٜ3߀3bkj9,%T~Q\|/*aVR9+{ſ:6;n#RhfuK}qC:|S$>Z*ь}3PŎE;8斊LsF'zZ=GZ@&xTzzG[wGyjїSa3zƤ9]5}n<>k[Mi H|Xw5]qb*)@QNPP(ڊ)tPњ;E J\(4 ;RQڎu4Q@ъ;GsF8QڊGn0̄mڥ֢BRGZ`ws@UF{m ҭPx^6WBvhu8d9F8ՋtwJG!]cY{H~t2/2j}jrqҫjA*TR[yUR@ Lq[4).9;Jn 8$!*768N|R4Sk!Nx[Ylejحvk_pncu'z]l7\ã^ XH$c3FmA{Xln#$Q3ˏ0(A0*o:H2 4 NV=U}V*%RƓQT[P}SnQJU&,1.e9-޺ܬYly͓zk$Q"yzT\٤8eQ+Ҏ렚oTXRo&~޵&)4ĬzId&z"?#[SR>8=ʴFeQ21QJ@YJ/OB7Ddc+ќ{W$%OPjUy$^79֗Ngt![u}s6؃-OZӼI}biq.vzړj3nznG HIcWFVF09SVg8v7hTC/m7m:N|O'_uŠ.?tfURN >W>mҟ [*8?BxɭSЃTv1V;Սb1 UhJzqW29&y$Ԥm :I=S@.W'UrGb9)S7:c5"7'OzЊh5 R+4Req֔fU([# Q1U-VM' {ռ[QR֙"Q)h.m"*=I 8nQکIxV],w&O9i▊NM'Qwb)PLtE(Ji)h)i(4Ph4x~j+V=aM]2|/Q)uUs_#s: ntUWPf؛!afBˏUKUWb @RH9 l2RxW<Ȥg|Z)74<!W%x^JzS\~z.+D|#OII=hҤbRњNLZ(=)P (0+AZIkuMy5nZs[O'na'ν&0K IF[iX? \M6jp[jqG81۶uXwz.#Vļ俞 f+@Òrr r*j#̒\(U^$Ԁk^][p>dw59KAedt# W#\"PLrqcו%y;~fEp\ 1=kvy`i-.$ymk0~qڱlx_$EXB <:nX:I"%ыmΧXAdt!/;AA;Hw5 /cn 5-HKnyL-k9:qq;Q1E*g5de%*nEU`smf ~ﻟ_©{)˩ȷ`dyQu ?+V Vф^X9Ae{qw+2@aGڴhn> dTkolxܡq~<~ɴhppJW%Ў0yǯOǕd^_jf҆qD{*kt_+hՄ$܄iTԤ؜|~|UZծ anrsWtB]{FblOz~XTN@ڟRٝIsMZ4X520{ֹu4wAN4B^FZٽ}q]|*[xcI G;:~8u]%/ܡ|1zt/.6w~9:֍)j\hz3U/+H aX&9EgJ`.qT*WotG[J:RD]hw/?N\۸xPør"ȥVzW#Ij@MœOZ㋳:H}NJ:6:YYX(8׭ɠ)[2 $ 6+{!^67FOV>aD8c:{ZA I nhFqM x5z$cM;qIqz`W&F85ovb8'rz;>SL)D4409Ufj3&jq)s+sis"$M3HO4w x4MR5J> PhޒZAGz)zvALnjuɃ5tUi;j Z|=ƻ!Oj]Vkx<(5OftTIV$ǘ\|xۜJծWW֭.fmvebVEӣ]K~b5Џ0?1wwƷ-%/cfvDox]Qa1&тAbrIHV/5#fi"<ٓs*݃lg]ZmS~C2 ~Wt9x$2ą@,0 q? | WTa.;q|:3on&,}֪Є\QE @Q@ :Qj3QP܃IKRPMRѯ˛d(h3kq}ue:Mk򀸟@9s]US VY7&3G;IV 3ܹ}p}0uE\Nd?AUFKw),2G#ڸYA,Sk-/n-Wǯh,jeaoԎ$M[wWm=swaϦ>;~wZ޶mR{wI|2P=CEmKloozc]. {{He= ˯Ec9Ocʞ'/ZL斐zQE-袊:GjZJZ(=(;GJ(QZ;Ҋ(E@IK((F)hFiipI&IK_#>$"C,<['IO&>N#u#ׄCkm#]QResճLx^?{ 606rvLqژm<2[񹹅K!aUn/mA3*[lm U4;Am/Y1 %V^'5]L\HT ĥrTŏjf=ͦ>ٮq X{PCooI-[-2ThUnw&>գ2"I^_EZ:d:iYyF77$ǥa/yaWq9YV5,,knѺڤODy^97~{^?"`vHFGCqVCJee 2ǟwUFR#=Yzvm+Ү cW?jMh/`:^'lqOV"Ӑy=+Ӯu-HrA֌Z )i+IQKC.% sؿխ*8#c-֬.-[JJXH| tکKto4?Ld.u˱( 7ɱc@>%M]-ꎄ )'WSЩ>p_Sxmrl4[1=0ǃu9ټ)s"g| q3MnCNw=̋吞}jo 0)pZ M:c'<z 2x9Q2l*ӹdBFɒ1ֹG2iwW^Tn~S4ke_<0*+nZdyl(AI,exW8tFD[y9``­%27S /G%8*YSi`s?yҋ:M\saHA(99g8CשRNrA_wTs6ڭe~vE:QGdƼCok35Ď@^F~xP_%̙e5RBsrƎ4o i:c'ek>wZ(oViCb!)e2s՝\xT9@~ɯ&Ϥ ih8͚⒲4u-7sKH4vt<JZLb (zzȒ82 , ģ};u:0l6Gph@fzdտit+9\n#<8 -?PMTv#Ҧ5'daEaz]ĸ7V7ľε55;8_|R Q@~Ln4jx8_[c%{Qސ =h(h)1EIK@%-%f(P{ƃIހ 3%sE%hhyQEQPEGܻvޤX~(K+;mJ=dTC·;W6o2T(=A4>9hD!*GB <'dq-2֎}v|:X|/s+V7:Hb״b$0>o4Gi#v 1Z.#_h)omc'ޠ d栯"e+irZQw xncKZc9a׃8'Un1,1NF3F ߠ5kAv}<| vZJQ44żK0#L +>sQh&)] iǥNj;xJ?~ҙiG  Vrj);QadfU퉖if~U zV_0+k-BT#GQ"An$1[Y271{Z=W1J曌R.h_Hϭ.NiVvE} M= h犭2lpQt$sNN:RT4Nٯ|~E,kZJ/tm,ۥOsdsFA[k}^A}|/{as-u%Τ4s$3ѭSv}<,o0"?p=oKCSP1u^+潷p@zqsksۤd,m؆-&ޏj;D*r 6;Ym]Jz+7lF+}@f_t sxwYϱw|EbuL{c?Ob8Wu֝=@=oF&&Bp랔Ez>NqWmRgKgV SiZW8R8A$G3Tg}?Mv7{Ӻ# krU #Aԭ J=yyp;9q hi9ݟırppy旦0}{(3߶918Zc)Hyo€̸<5,BFҗ?JҮ^2d#c ϿSRkbe%foG"2"ڰmH'j[-FEtFic% Z`-%CFi8aXפ_G\:ytUD1kű u5iǚ2@Znt$ בaDaV0[$݀/.Jqs2˂W?BTQ7;]-[͚f&#HdXoh|X*?w"["كR6{T6_RUHÁ ~µ2wD}T;3}`UdN? stJ ^r5?V++Dm{pb wZeQGz(RGj1GCzH/ғ0Җ;Ph"(4Q@,p 6CA#=pqs:ٳ[B4O*՚)\`a 9 s]xvu ) $#034e/i}*9ϦEAjĚw^Z#;0}yuǤ%>b*sqs}+HտLʱb mF @PM)4.7)#֟XZu[ٷJdA#SE @QގPhu(ǥf(PhRQK@ EQ@y4QF)h1KIZ("~R+Ov;}K֥)DY6vՒI-dh8ʏf*R21|^<5z7.T)> &1{[Ht{QI_+$`֥mX2Ypi-NiE6>!nIQ9 \57UFbU5x/WݣYgHWV8'Wm"u\TufEpNA9E6F f=gZZVKi#WJy#otu銴pBwzCjViqLc<`Jۈ$Z۴k`OҮ[-̓\ûQޖԡJih.m sø\!V!y` Б]Mdj{<7pAGI *ux8#ڳvgPDv$sV:VuqMhL,[1Sʑ܊SK.ǐ)E#});ӥNwubB%NFE.s $izJT0 A ;46Լ=k}*FT-9]3xwee$T=nmbJOMr~(BW đ{c>{ȧaN|=ser|~ĖZՋZ]K'a7O%֒0R}X$IIYXk|օMLyLnYM畛8jVֶhlIVcu{P eu2湟?Qu؊i/4I^ǸU)܃?|sڹupZcA qP1ӽl"Rʲ’9-.ddؒ 1I+D@6J`3QQ0+s랶(&X2*g>c/ jo%qCu ,+w9#pO2Q>8zVEnzZ3IJFҡ@##Cih"#8Y~B(Q_\?ǹeF2Z#=yQF?Z&#BYvT JZ)e#y諝ЍtUD0wPmQaЌ >$_[?}ORX®O]1W4ˉM15-Vf̐^lؑ) קhO=vͳe>to`5SH>ZZJZGzJ^QЊ()QEiR4 :f 3A4VOPRxᑽA+RҖ$y$}+f,ن2ߠi9Ve TIdSr0-+\c -jb Z1 PI49)擯4u%/9c4Pњ(ր製К^c"1E-裥QEv&)MQGZ;ўhPJ)NzғrnMocx [Qb/kDG^UEP)MlIVq5/u5A5SJhs&VZʧ5ՉUu+%PԌ[Iдr˵$\@IHgukx殺;SpÁuNnfWJ׊OllI?OaSKd'~r3}_IHb)cN6MB(^k"/'6i3oc8P_ܹ=-owօ'>WqvQ֌S C֗S%p0h/ ,fFcU5G%Ͷ7[LCӜ5ewc \2CWя Ӥg|ԩǥ2 4)m !zdQQ6 f V]r0ue'5aܦHWsE"#Њ1RmWZ &3#PJ\Xk~Gh&$yzT)HP*?Ts5{W25ԂdW6vbIPaN!vƃjMneJJV&yQ1T`:Q@ OAOQ\"?=#IQE =+Rɣ>-Z4)US*{헥qRC)F}gXWnmtcl5RS5=QG<D̊8* Kk;++_AqKm$Mk v?_֣&mj W#Ч̌=IW3xyo~%a֮3"OZH̶Inla㚭/\Knɹ*$F+/uΌ=qH> XXjx/,8yb[}Ο {}2`k1'ca<Xsی~k:]PqOǭiritw{ds/Z-avE8\=W4[bP>IJJ2e'n ծHyzro>;b$rs]>NEgӮ;i4-RWӁ] krlQqֳrw3˅wX1TO}G5kRՔێ8?LQ\jkr{Z7Skϔ\]s+pcL ϯLӇҐd kIO=k<)>`pzqFN,EKFo.yh$p7֖kfgVX2~k%G1T^IO,6«y~zRfѧd be0z.|AڪMHs+\L%t%ǎG>Et9z&r]!\=l#w&p'-wOě맏UGq2,WDIq *_D99=$ܡ1hJOv^+evy?6}+( Pq8ֳoM\| w#+B-ImѴ/IUǶ+[J%@f#Zei0)cԒCWLX+==(?ϭ.GCTqC4"7d0$}ig&EK`.2 d0:rr^7}p3{z'[ čhꋿJR2 ?T<"+qZӨ ~lK1"J{f!ҿt[E!dur3qñ`RhUa+]W+30تF{Uw۔=sӭL6P~=XM2y(Xxu)e9T٫T`Mlsr%+n#XE?0$7I~; KU{*Ƴ]@EqĈ1Ev"HȊAU_z44sT4P&.!x@Ѹ)+ ͼ;yomnM>FO-Z)0[dvZ:ΨN,;U}MasMԴcwyN+)n~VSSy/JeywU93CHc% lgLQgIEu/N5qZ;(⹻]RVQ`Oz/4 ђd\?([Vv UΥL ;>Ӭq=embsyhʽʂ1Z6څ̀zʾѕ}iT8(e4TѮW9fAl?ZCK;11KEw=i( U[6X?ڗ[3]GS-XћlouF;<5+tBj½bFX<;GA,{ VwG(Sv׮h#6m8!NOP0i/8I<|/<[E af gAO0+R;Qg55?]mYɉW)F).jn'D2du-8+ռ=x~B]OO'w_ҽL-5{$KqB;y510M4Huk+(k8Ї$``[L߃=nOQ𖍪sȃ\\f B^M}`ّvnW[Xa$ijo*T1cvت6zfZeH +#;G,sⶼ9[iq:Gl MJ/ͅ[qm"2GnlNi_i7[yaqGCta``.Ǹڛ;+[o0ƩXLBHb=:T- 9qI8T8VM]\t[24+)aVkr?U-s;?s4jE)c?89Չ:^Mniy}8<Ҁp?Z^8$cۊ˺ⴒBLaM* =p+KsOs0"<*3e<)^" X@'N1J]RX@%dS8?\r /٥X-&=vc,Iu0Ha > +X ;!?_?0E\ ortwHFG:pu5 ⮸@l+#SYc#ζ ?7{W {)nxjf$f/d?j_QYIѦO@<8gx.ЬnV"؆6kxڬAṀ~A'#+m.&&dTλ5)jnc\zmi%HD2Eq'j-"ۛKVr8+Vf6SO \^J}R؇z;uQ@ޖR;REtڎ @ ?QPZwYZyIhזqN+*^y#79~Ѐ#\`t%c{Qd6jȹp##޷#9nn){ JGKʎ*+1jfcr s+.%f-WܧP?Z݆h!IadUCM 䔝zފC /zR Z:PGz1Ec4v^'n(KHbuIڎQފ( aY dCЩ(Hy5Gk/c63ֺ0d  JN Ҁo@+i|)`\J: wzo-%) 1ƁރցZJZ%RԴyV5v֚m;7~$762{qz݊IOKbÌ68aWrMk2i,rie=:\#[XhߒTuĺEטj# VqɳDiZ;$Wvwp9U`N=_Φ-3H|!x4MrM%/?_Wgw:&O,$-۟Һ/ =N;kX(~Y#c=r+kHƕn i6sT5ˡm`'tEBWv!+6Mab t?[S\ %Wɮ7"F[6j8 Ҍ`gk1Qs@ J3JoetR[y.}9Dyz:/k"%@) >s8)}ZWr3=ųY]=HM. xe"x{V1޹o M}_줐bGKpIOJrMiVQ1NVfWϚeB>2*8- ~cOznlg5-'j XmGMmGJԬ R?3Ց%M-@ee?N dp5rY\g|bTVqO<`Rѵ.uxnEk'x];SS9jG/_Q?rK^\ ̷7,}?uF~:Ji@lul"OS.ަRCss~2_\Q(!+&y99WH8KՈ|QֳqL渝GL & kVRl)\$r=q+sU5Sor!:}Edgi=m.--eh30z;duTawk;>lW#ӥJonclȱuFG| )gl|pr)3Z5*{/5;kU ?g8 l^"SfרޮmlZB; At9PERORъ^ LўwJFh4 ;R׊}i}(I1-2I  mbܾp}֏ku۱z¹{ [ x1)WYmX^K[yu *uYI&(易vVVnNw"&˸ 33km?588#S6vE*kd')?]44l̢K+{Hmuu?.yE绽_;V\lCɟ~X)[rY"N[r>9:lm+Wi=fmr1 zVr6ɍmaELިN:` u!u&9=NxH^M4pGFG^1Ҁz^Aבhב@'c4F&Aӎ01BxZL0AR4WH8pq]u#'_*ĻUeNAoZq.BjQܗM OG ʟUe6LHF<ޮT6=(r:zbج:uYNcӧ_}'U3("m{iE Nwq\hf!X~"K9u*1=-y:p= nTWVyk-1ʅF)0LVȄW}{QtOٗ MfMtN#19dV< 塀|m8_hjŎ n"Ŝ<Uz>ssfr;{t<Ĥ1Kϖx>$`PҤE/j+59$EdUؼj` Zũ9_q%S1J>p?OUV7Ss,I#`UfP؎՛weʳHyz=I^:Gv2Luϵgx3ۻ__W5mR $>D.5fx  Zu2]70E:_4 sAR:8Sg|GB gW՝Z);UA}POԖ\ZJ*Cuemz.AYP0r,F?x[?wl0A^k-@[۪ ާTw7i!-䘑Tc,A c#>G>`` ݌bv=pcsV KhVE{Ǟ fj-"k="m/"ֆ2mMw犂Q&Æ7խgۣb@7|1V<ds@ w$ڧ>TzOuh)(MwXг*kk\ވ^Eil@X^? n_MGֶy8OzC*Tcyز|֌d}3W5+KkP>㨨u PiΞm c}Q((9 MX፤#Qv8 =MEqQ?fjV#ABr07ԜoJ$ӷ7reHrUd.YM.;T2<ǾOҥPSk"# % l*z\z –ZbbGwZIa4gg8 ]KK1d[kOior\AOD k{#,8P}=Ui (vL2>EPF\WYe27 P{tf8:X1 knCg5Njj汕џ}!xdץ%e˽i>[޴˜t^֣倬`1֪q@czĩ64++}n nW1J{W&m oBW Dl@ob?hǾ%F g=)r\,wd)SW#{g!Gja_Gl,u<78^sɮRmbxd+3U$fw;O$}c[!L0yT$sO 3+st rz>U52 RjגS>sOac>d M`ksN8~E>}:عF{t ,l$!xSՉ#_:]<^\1XQ 1-t9s;^\O?W]\~,q|H2:k{EQި̭wjf),-x>hFR8#qAuN&ݺ A-Goʓ5d:ͽ: MVѭQ #{l(S"L`{pn-fEWN]OOع$%rV=-N>nY 6>8WiҚaOMF66>\7K}B] 6̃KXs-EŖщhc;c'ݘ.-l@>-ēLǔscQEo'ye#pblw?/lu?R}?} Kr.H+r1TzIfG<,`~#n @2 ް53B?]鑏ho//ctrt#z{*h-Kyh39L̬iN|R3z_̲MJJʙdRH|J۷"ey$ \9b\t(ɦEHTi]YSڙUrtx`~u9YD+ 0kw$b.sIVNw?gyP`Hu<߯3EzS#&dцC)?Jwj㵇fkf.A,þ3{݅RXg#\OGmNOӞYYYXj|{!&42#,@"7F1]e_f39f>zk<Nd"bJ3a}*YٚG;X|`֜裚ns |nӁpyC25S2KR(p4I+8>Cdušp#U:SFLX*9nhw? Ah c-ր$PO w6gI@QSg>lqQ1)OHvoΧW$Gc#XR> [ 2bx2{Ӛ[hbsEzRm/QIޗ`GJ;RA4Qހ@ENՋ<5j?m<,vY] \5p9+~~s~74YuIKH< ()q@=(y JŔ_i>}+'à)o0 h ^R+Ē=[4o]*{Љbx>Q*C\۷z3k~9ZwЃA֤7)bɳS6ӧ#kGmr>wj}m0|g2q\.KC$EcJc$RF:]bilZ)]YW=qCе->M6 v_ݬ[8bܛ} Ƶx*kH c+ԼC%,l/aWnB0?Is~%[31n[ :di%mA#)5({}%/5HH+{ԝLdظfKIehTq<\aчGPo qjV+Mu`bhƏHӛ#sN-n8UXVObKsZTVP9T$wq~dt=2fwܼy\xm5-%FAݷ0 !{kANŜnsOsYkM= M y#?Joqu:"UZ8%5Z%v6qd7B1N p9Z~uOC#Y.FV=H_3[em4pF8Qj| vb3K7 ̳OG&-&2ǹTgbUw𢚈\Aިjd;IhV^`1ۨmzOR9sKd_~bL׵Ut{74kSLxQWxP[e͂U9Aq"'&upj=աIBt0VVAW%ExdGS~D¶5Ruq\g4c!/R?3Q\Gw2G":+3ӧ+p>]Òji:RipW/0 ֍iRv*S} DXČr/#~ DՍkc+i>]ep+:Z JQ4qZQz!c~]kfWg<=2?xTD) hwqGfќd~}h1 g:Rᝌg>RRx{I:f qQ0ZRݐ0ctas]Rhuq|y>[o\/?SEuؽ~ˇ_U>][Ew2W5Vd՘zSM*XFGop3i9;>WE=UU$I:cmiK#*xxw͕9s}6J(Z;Nާjz G%x4L;Zs&hcuB*z=Gڲtf:NWq7E#04~DA:c չg20>tc8w"V9NYLAAH?jwYO'h9?+42[n, l7<Vgu4ĿuX*jQ*}I=`ia*|}Szv>P!wYwKnw <zݧ!tGIU`G_j:@ӧűE?,Zs KHLo0(Ԯ%V 띎 d+j+x"VYz#Ҵe @h*,[K[آ-+*d)c?ȊG84MVp?1\>mNW-ǿJ,"7(=ޤEڗ<>Z=kSZti+݆'TWSLnۿ ~?x/nG~IY8 T*8STS}h>1? Bʭ}YO#Xڂ:q+aC淙 sIn|z>r%h>ҧ.JtƏKYc.dLGv KXk/"]YM9nv~OA[Yvٞ3FqL-vֺ]RWc$'0b>j7'[{VWh!gϔTN~ 1뚹BT#w5MYZAMmgo o%V<zj~YuWG|ʁ;F8&on%3s:5{9ڶ43Ypœ_-k^mlI|Fs͋y4-CN孧Mo4 ;0,I5c4:#>FtRĜ(<PkO|?$F+ؐ/z? 2MM~X|x:Ŭq%:wՍuI.-8"8 2k7ZÙ$ĶA@:Gŗ{f2_:N]E.{%A6>eoUh=)!)Qk|<2GHmTKr-7W-rk$j"aҏ\z Hh\)KrrQ]s\,|t!_mɱ'S]O𾧟㦁HFF)^Ǜ s_V=hJAސ :+1kƌr~P O. 'Z_3 5qq`ζ, /<A֧*OGqnnrDAkrn7f7cv[2F?#U,W7I vv,ŋ[:'+"g$:L&UqHv5tWCd*U>I5%/%mn'8~y)Q 8=WS2l-9E@S cF2 <γiFQ=8F}Bi'nf%޵1ƒ^ܖ"B U%C KAK,ň*8@EWG^1ꭎuGh=1JIILyQ;Wi2iv0KK<UьXu<Ƽawn\OsGE 5Bƫ~c+zе'Fq}jYo_*P} 3E'z+!8;Q@H{!z@QGz(4RځgO WGZ-G endstream endobj 43 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 1022 /Height 282 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 45907 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?opo FJ]Б~>ǩ[_/ !{~C1֕Gyjs[ɝ)\{޽.e,b=w5Q&kG 1Tf#(e* Ta?%?'W9&e EVT}|*jx!j]Nd[Zױbf@6NO??QǭQޙOTk2Ia$,z3zbjiN/m'%OqZ.yay5b[xuA {)'au܁,#||3eG늫ưoaf^7 <{7cLŘ{\2a)Nm/ .>xߐxʞ㷭CirVL8nS{ur;] 9WCC؃@ʷh6m-;u;nsL9pd$g Lų"uhCߕ]u\9(01Vs4֌wȸ=4&Nܒ:Ӊ8Odunp x8,YT &BΠnsiH(*q#h'~NNpG֪G7zp֬5 *[۵ 2>NJx'a]L_I1!1$K3qZ1;.#__R붴EG c%yUǩ<ՠ,|HO:3q4նdqqaE-@6aЏS=+AHb0xstKȂ[;(3atrpZf>#v\'Gg^JFcjQM#e-TC9g9i% -7vcL̒|܁RsOI:ci(?媒!x4WRy7FZy\]+Czv,sxms֒Bwʀ3Ȍ+ rNC+jeae9Uä7 dئi6 d!L esuq-HFKXhkzru?QmQ$D wE[PYCp=ė*,]w0Dܮ T~(2Bi@YMf:gzf.obH᷐KB8z$A ] ^~kVYiG6Z}u*'|ۭY Vi pBn,K1bXI$95 ei$AV]c_ZE )^iw4fbc+.lm줳 &NN*A@ i+KInH 03qiHFH}}j%0 GKxvOzKK{KXJdeǩRzf$'  y\g >Qt.Ԫ)R~ޜlHUuo[E< !q֒ \yn`%Ydr8 $fcVa 4ek6T˱I8}+<\yM9{j!`Ac@s֬Х2C*E*}LHi@I6@cbG*+nX6dY#aF{ǷyVPZKy Lr }w?9zҊiY;Ki}ȑ \G~bU}j}vv~b05mn;MrG!N8֩-.ΚTҏ<}MO]0i#s'UfpԖ*H+gnAt\vXKyZE9) k ٔ3#vxΝ,ޏ7J y͒3'vtVY+/E!%R+I̬+PKMR!]NbB!~t=Gfkұ`^s=AOOzC#\0`_z2pxiJ61ӵV;k@.%G=F:qgj?|Vmޝ09emY3g봞AE9i!])@ RbY&2MK-onV屑Rq;,;:I\]LcCМB?$YbJK^ r纞qֵyؔ[fdDK%P>[8!}S{v#sGcQkIyqD [Ŕ`}"k$n]8n1қ;߀2&?ti9"9[;c{T7ߐ) 4 HvJpӎ@Lwq8 Syn=G;Su <8 b89bFIK9Jg埐Jp1szpUf`{ 9E?td|^"y L"fI-}GpyIXڕo-碸v>ս+R]Fݙql9("ԴyRPFx斐 KE%-%h(i):@/%kkFE-LjTxڅڴz"3E5 ɬ]yqj iuaFȱkw`w8q׭8:˕c#)vAolgҢSӝUI͖Tx4K $vUn,H_uvйF(CW[1Fhiq$gdJQ+-J2{qQEkG5-9pqq:J?j ))iME%0,"4 ~i'W )ff8j$wIh6(vtfSJ麒DT-ˤ OAֺ-ᴁ "P` XGi[DB-ChC.ǀ?:neVȗZ ]-3ѕPk^&w{]2M;X v֏4ҪNȦES8iVáRr/xv/A4KR\J+RE&GJ;<9q%fqes.7 Pmwe#-'7Oԗhõm\{ַ֕PAȘMvO#NZ5̙`&cy#t&w}־lWos4,OʋWMr}ZU+uUxuU'  ]GazģV]&ZH(T{N7p\UF*H(,ܠasٹРII ?j. mq7 Ȼ[ם/ &_1HF8t=-zy'dp|9H9 I5gP""I%HgeŁ9T/;q%–3G(Fق7C#ܚTQmT[Ƶ1ZC`vw\Juסbq7n&cSv-Sak5 +K;]:4Qf?Nttz])io{fC#C3ךVh<^WzSFs1G%Ŷ am~kȅV љQNٰ۽)HUg tɡf"l'c{|zջv]M#Hta2AroB; ZS_=Y <ĐHVlL%ߧXFݎljpc$sI*H2vmfVYpX ㏭5-]zd9WdL(a_:8KxB `p1Q7u2TzwW 71>'#ڱ*S$¯>d;Xqc 7r۠`ҹO;Ά[1kt՜k m]d5:2ڝє;})H"4duFv={b::'<}Eh0Af1-c t42kU'}}kt-BU{#ѫǷP]>+ \ʲ.$c8ֵ#}cR?e尳[$dWq9LSd3֪-œm+$J :{}(t lRn*FDѺ8op9zϘplP3姩lxp Ĉ1V+K9&2ހrhP>xɤc?){Um3Sխ~hМ Z>29i ldӵ5;Tc0`7 A#HÐ/;|jL`T,W =jHcW;Tdrrk;QaŪddF2|`5khQje%\8eĞ9@(rujA\ΛiinM&2 -tC(e9EfՍ袗!J3%/ 4^bJZ;E%(􂗵%6SORا'8*ai79S[ݫ#]I~-Ι;~]c!#)9K頎61JD38-چMmrП:YR**k&jl,,?VtR(LVnUwz8K~LX7 ("i"yی?"{֡9ڰIKI@59;.xbj)u_23(9,?Pͩ_xI]ߖsU5fghȔE0v9&*펠(F^?:]ô}\)ՆFᶐzVeȰ1-7ļr1:EiUt*:5/jKXYwW.RG3COOUľѬgR h/Ac@HdymM|J_Vh"N~fffCC!su ಑#^YC;g \-ei+^$1y$Y#duA"{R[Vi`ƃ< S@sjf+\(Sl`ZdΡt%+$ AݰJZM.P` ׎284i?:p$3[^j`dG67k uIhn8#γt5S[⹵ZIToC]zh滒{ebN;LU+o iK3@f"X?Syuw+ NDddUm[OҦϸ[0*POsں:uOOQ$l,R=ÝOAG&JFG @FW-#N95LMn<3F:U[X- h ExCD6 4+>#~6zcoPj\i'ک^Z />PIW{j'coGjɷ%qqv ѽ0ɫP_, "lþ f]ɨHaQ7FZ]R$9J6κ:Tq*ݥsMdk8ăȏ7Pds~sfIf)JL@p^3SUUIa= y`SC0/Tdq]_h)#*If >IE]& .Yx6O!F=H7\΄|n M[_Pml$죚:@M-Wt \hiO&v!OOµkBM/¶l˻.[{g۰*oov8Ἰ$a*O\y>cs\8zQ]]=l [\}q}.ׄ {s[Vs5Ų8*k;5kEGjAGEf-Q@5;#}fc"95{~e]St҉{gw]OFa B+O$ ~-uHku0֦F:0]BdSFaoʧz 6žQGi>v\_d?|Ԛ=Q8b>{LIQKHSN*78F<hљײV nHx[NcpZsԊIT܌ D+9b;|`أ#imЈ;s۞+;.Yi8HىQ@$BC*w8ێ̧޳hOHISR'V.IpFbd{I|qҷcD~PxQԄ0EL󥭚̎fդ2,k[,j@R0 LӡO٦pyt'f%{ l֬wObӾ<(f‚qNX[~ sI\Lv}x82YC{]:A%}I>qҶ 8aUFDđā#@UFvCw7I#W&OnlJ1XZq7'LCږ0AU=,,;!I湟˭N>G]/s\_Y;GGY 2#Ԛ&s; o!t|K9m^evc@3k\72yN LpHk<乩k' ʐ:vtf)5ŻaX%kCrEK4M U,ʈIqcߊ}7 nO'Oi iaorE֥r/c3Ϸg-/.%t<3`1ɩ.4+湽j(I@Qn==6KI+}9m4-Uu8h &nn`09W^=+#W$#ӭndC KvIjfYM__-QNG֕ts:N}ѭ,ݯ8h[ėw tX "e!S뱁֭b:9f bQGzKx\K8e|'_ӠϬk㸭@l .o-_jH?in+#\sHhp8k^_gw5\xズZMX;KW~ hpZ Ac]mqAIHC/ޥuT6 -lJ~aUhufkxU?y dHBFi{ Fbp!:NHhe6n1z84KZ_.(2Eb$nO*r,цUK*y:dFGQYZ![WH\ yp?CU#9%-FBv۲ m %iT<{´#֪bE/1ކkM#ΖZC>UqrE2?T<[h6d?b${{(k-4iBP0R5KA-'## b*%Ktf ;0= l&LZœ[yGITcP#$1x@gP+ˆq¬[[ p?(# ;(9G8I } G/j~R8oT1A ∪_h<.@Y9=iNIZV<@x#~(`crz{ mv\)ǀ;Vd`/Z& h 篥Dҧ$YQXZERqU"ШfxfAs׷kGP,129?s*RjOTgGu,I\~K!cgpS/_ƴ!FW1tԺrjԹZՕ.,ϟ ^.^[nWW;ku2uu{°=WVap?GQ[1 r)qU{8.RIR6ʄ^Gn*[4,Gc8 mHz9ٻ`Re)>,e3Ona\!9%=2Eq{2vZ.m n#%FAAciQO%cOK(PHַY>%4&!*);GѥRAsfTsY{8*x~)v 34m AR@8~2Y:VL9ldO?Ґ 883ڑX#9I04߳)xбOU?"WpSăCZy|ze5dm=AQRƝ+kN,rGsmne%8%wp玕ey w69FA};xڱw'4QIۚChKI@7w|Ak.,dbHbOvtS>Z(Ht^Nk9kj4[_?Kzu>9ЮlW2{f]]5I+̮?N_qGvf#ON?wކ%sZk4l{?ҷ2%rP4C wZ@a@u%؈F( ;93mdiɺItw] ϝ@?psRrzȥ[Ish sk%5EjVǡ5]҂Srzj亀旵\Rwp4WR2@Ͻ44-q[jnӼmE9\ 'QP{q Z*(2W\=M+fzB_E)XlKctH=@׈N,~iZdJR&2J@䪂sߩx<:q!ATw3}=a_R-" KN{r1R;WH$F7Y6rԤdzby"I 6Mҥ%ZWbZl #S}V[.*)ь6DF ;6=m/LRGum7))ēDJ qI Io CHU-V'J#7Z fOj絭fseY`IV{qe$I3VOX٘tɫ Xm ޹u̷ OlVy܎8Ð{ uE+h"yuKh"RR6  L]OjL.BѨXIkt~4Hc7[8I]`/qH9MPaPn1)JZ܋k#h&W?xN, &#?(:ÚW{-K%s}*F1^޴<@:ĢpV-F׃ٝq?ZSdEV}|Lۆ;|l_0ҹkkն mơLb2A9]_:">q,U>TN=kЃFc[+y{d-P;n^ۏJ묯aBN2C+ 2؊ =3Lv~e5ƺNu+#?P{W5HKj((dsI=MPt<SGHA+:}{U?%' "p=}Mtp*QiZ1({uZUIa%v'eVO*_"\2:5ujCѽMR +GKy_I###ޫ[Qđ<%[ԐĚ)PtIΐfǷ$uz(t(+"p}AGL[R:!Ʈu$=ՅZ I=7)c,u[Gy{rruUs Fƍ5QK;Q$)j)-WVnOL֘-Շ#)@!sڬDIlh%[>Vv>F֎_8F'=BL!{RGL߻ QE-3Jmry7c =Az-8B#Sc= >I์Gs\)08#ճwY_8@C }EUp(\=4.Y#iº|]8䷕$LH1|ho(33#C9 ;?V GTly4 S:G#6ߙP{YXXAj^\*n uc TMi 70HϿUʐ22#?9$hcb?5N\Շ*4i}6V917k:}_coֹ(\#&\EL(羇^砣3qפcL!TNmehMuoΝ<} \62x0N$=~5H K q?;⛓[> }PZ;[ݕC6(:I}dw-=uB3jmw8oT3/:{K4 Yx. O8ӱ:U [29.T%“:+GZYIE=RtY,'${ݵL guK;P2I\ωf!K:It"=KYYXB |O] g K.ԤLȶSLZͩ]@b(ϢO淂PÊuS:(bU^47Y: A]˂3Gկ⧺1ťZI$ "Enrlϲ\:gS =*z}Lk3IԴi5As eQUmY;I-b+Y=d"J(NSYquHySy+3U?cmH[*2#M6xK2%W^qsC[4(Gz RhZHl9glZIgnIp=MehM<n?δzޥ!Ѵ8wphio]PzEog Hܖl{,Es^'5oc(p+XZ_S# }PKr+Of\ZYɭ.$;;-dӦ*!1‚nedDXtq;{y`lߗ*uOҙK+59X;`cvN]\jW7n 9(!48|=FI)lհԬEcw[QtFOQvH8 Z^C1͚2) FJ}~zlFhXUU>r[i$sY0ǽgR3,UF6^\:g0rVrh!QA[6(eXOB!F*(֕KhgIKhs-~K4 &mAq8ouvs4̦Y>P 󮲚@:dTFq޳RV-(FB" q5z fXxc$)8#o=}v(cH vgI'%>iVpѹwc'|: 3kbWŗE>b*Us|5^zYbͺԡ24f2J㧦o^X@"B\mbrG"h.U9v--n#OareXTlv<>j]R]nnr17ܫsH[c r3;2$sҥ-.~_9 on g^)&'t+zKyw4qۘ(#AZNm0Bɽr7yCAXח$I5V2P\wo,9X)ܡdc֓"g{DL"[rSV.mXGrO{TP̗mqm3Ӟڑԓ}:n#̶1uR1}\e(م%-Pc5 '-6d;~ {;su"mFvQx"o v~'~>U1$),?Z$ct-v!a,LJc2OnP&Lppe9vFݱ`g1X#8UnWF vxͪ6{ysRL61p8 gҺ%#< 5)XԒgt,9r"lw?JڨiW^\%J{jK1W*48q+#[Z^g[ O/!,{)h1H@<\њ@F#J'PjNO 觌Vw)SЌqQ7t%0PS1){QށMuW]@6(I9jm͍цjr֑}*_e4^/<`S\2*59?Zҭ-4q <տΆS*[l LI2O`8X4 \-5xw.qRs:VLPo\p?-ګia[Z'݂%UƑV- pA&V5>"v \ nN<j(1si^;w4˾ ProXo-7F] ՠ-~F|1Ɂ#v+ S0))lWKHsRTUbMia"T`YMU ~Sw&\H-V_Ge gW֨iR\~MRs?*V 8Qꔕ%+#Lw:Udh' ,tȸԦ/cDb ӵ/{p @p>[욄M{;e ɓ8<`j-JW+qtGpAێÁVMեմqMm!} ⱙZJ^ +ćx;x41 t}-uARl6,#9xUId83)=IjKyh1c;{U+ lk,HuG eH Er"?K Z])giNcYK#er;KE`&2 tet- a` ݙ\dlVԺD#i![ϯ`t!ŢD4?z82p~}YMYn )UV>ִr#ee=9zTc1uy#\]0?5$~n‡}͵յܑnOY4{~Um;Zv0rҕ##­jES3W2">Q5g*-t-+$d4LM[R7O^un=xz8-FّԫSo4k-TdY>YGr^YWhm ~B2՜q@8RRv:A8mlAGNEf陉ﭞIRX*2O'w}ORk xb-Fw~T#Fy=vqSи?[k)dHZyrFI<v@J$6n?:-幮NmW8/#a3]%= )HnJU%@Ѻ3{[u(3]1#>^;,Ѹcj܎{nOO@ 0C nv.piF[9e' aU>ZpGJ<"N+I6rc'YHxNyk i|&6@GLڧoqw`L1<dg:̍JOY2>A~S6p$L֦KB襬qF9 wFQwea6\ aF*vcnCDhJTg>y P%6j[o[ъ3EXъ)ޒ(qڔ%\E%(8QF)-xEQoƳm6xcDS=zZZ}ӌVmQ^\pn*n#t)p:񊞦#HN;fYK-ü 3Q*F#+Zb+eko4K:$Uc~n3޺gR2`WY48nhۈwE]oe%a>ʬoGJyornΤaFr$n#)Z4 q}}Nn]-Eo',7;}y5$зp$GlWB :jG,Wsʷ=w<ןZuH^UO<Z݃`uJ\׊tt}sYK~,e9ͳ lz}=Gkw"Ky(wFQm8eis(ӯ\ݮZT Vk-v8X&&Uٺ&LѩEEmqռsE 9jB)(RA/mX ) >ZIAQ+*~RVRAʞ9㸹؀G$x￷jo۳$mʿwSIlkC~$bQ$1aGRS!&d#  >}D&(GXKݩ! dc5v@]p[wp(q֭c+sw4oomf6rHVJO~1}*kRT$x(I9YsҦdyf`Lp*r jp+f')~ c$ݩBJr@{֍̂ pXg>j`PSÚ$ݑۄn[=n1 irs9sי$ʯq6V>h^@zzX,0nI qҬIwE t^{V`.#pCJ QurϜr_˥[[fKApiT c7}E:x#1L#:L[}Gqj[el~5Vm.<'< uz1ذg)HgpZX?i$&WP![5AE` ͹Z;y!{b;j@:%C+H7do2.4 /&L>bHH10 ߕmq$<GPGU=>=SHTƋG[.md~e?rL |އsRZ^Gt%%N$h=%ݫ5ŃWY€;l%$Դ;^;I,*=Iq;['R_Љ~,g+@>٭]2[]{V7o vG^ރ[6RPkQA K@'kx3TȢE  t4R6]Ǫ>t1ƍT {*(=Ps ;qGQAցGj)QsE4 IE-w_E%-'\{K k(F%&=OVRQ@4>$kgb#,9 ߣ6Fi(vh7K@ 3%⁋ZZ-2UbjA ŭ|-'cқ +k$sjcf>M4owP\P4Jxf޺ tw?~l+}A:նZ $($̳H6?j%&M2=3U@wګ[Q7l+1KH>կ$bA'Hw⇮N.!5搗S\bK+c#kӊEQ6dՉb;$?E [@ogSeyv>~T@kNNꢵ5y$Vg#+_SҢHN8\SԪϚfvíisYM|C\G .}RNls3a'׏^Oc-xN7VN-ӯTGKs&.wkcO⺴I !}/tk=9^zSQvzd$o \P?t~No7#t3Cywv3_6;9ɭjTh$փWM9QT/-~֋o|׭^G ^zk+[ҥԒ1^N 5ijL]jDDBsIjחEpѴmn[x@ܑpnQOI?:[籽[dOz /\P01NOyZi[H] |=wүYs6%5qw$%Űͫyq/2>vQ^EqnU ,Lg ~3XϦ3I -%p{~0Kg݅ 2$ Y뚽Y!ғNqE-^&%jk??']7jR.#e`К/׃MRfQHPFhEP1@W\HhGm#"s\~4 Vuki'/\sKdQ^۬Q9 #c7W^Wa)e(~h[fx㞼YV ,\?nQN$}UEP R?"/#ؾV6튭ni/٧r27qR$;&A;[wlؤʃms1V㜐bNjE`9+5͖ 5ִ]e`#EuRPMJoe(0X} Qd\1d^\{wƶk1:}̫/cUji=QJҶФ#ķ\܄$qmqu tS֬ot;rO$%URoCƨ91^5ȓw#9+&GR>1iֲ,-Nf?RCM"! ukz݂dhlɫ9VE4yVHte\2#{oZ/OeڴzUzY+lT&kyzԫW:[8Zֶ1[G9}k:|ug,iOOAeˌHjYF gh,Nk6!8sXA(P((M(w44ps&n"_;BƱvFXm18aiW=g WP @1b?RvONMƞӃ\6okRdP(Sve!Њ!TZ+zV:?.j24(6qzdЎKYlelުOO8>ӿ.SNOH6 12S3ս^ѵ&j6ȒV,8'^urpFk:Z=q[AsMir1"۩pU0jͶkh SՈa% j@AOR{}w"̏#F#=8sXm:8#D=:ᑤ/.̞v=jV!v{@Ψ-zfjxVy*`qq[5>E`chw?\BI$iњ^Ui3E0|Py'z#QH3E(Q@ tY2pA-t̶&Ke֎r?N}[-nἁfpOֳ5 )dscrcxU_Gp#,Yp18>IQvxFˢ#<%%1'mdf<'_N$H$e԰.qK,RG-N){9mnԠ3ǭF':?0robͼ4! jyE@'+lc!$qkRv`v}k2a%+r$ӏ^Oy}q~\G˺p.voyY:4ؙ8jdP3n~SVI&18_L r[7evsF.Nȭzuk~FIkK-!\tP`2ĞudF1GjRznvb)rYp:Zko~ RS|]SnGrN2F@Դ˒ݮ4냙"ADw;m^_h \Hd3gA}+kLK+XΆX=o$ۦGQԴ5x$ dKo9n:zS$X-U |%.0Ct${VFeok\hMwaoFEW`= csl5 :1xѱCj[iC `R:Q{܍08>d2 @<9Mt JkJe#aGV&Ȓ)VS׽\<8 3\i 5;yy/_BxrGI==A4:c?e"Z4RW#YP3}(ކ<: |Ec5Z=: HA }Y[ P0-H=hRt E)@,ws3p[3Q763Iқ S?jZ7ˢ:/eEIXJ=["+!H#Q֊2RL3*qnN\YW2fi9K=B >߼:ScIr[Bi(4/J(2z3E'P]Gcl˝p3⁤۲, =)qP-m€IdMVs> HxqҺlFX`2]EcVJ1#?) IOOhꈸk\ ml9P^]Jǧw'Ғ7AƯ3e?S[mp63+[ڼ׳I~'kE~U;D@9Fz(;ek7TZC̒@?ȧ9Yw"pw Uk;smhpqV#;_@ng˰CW".HYQjVI5ċQpwI}sSݿV/?z߅" :4s9Q^v/=zu :YDp^ ;H$ 䞬{O5I]G]W#t:x zXEнRlc7v-%-%2B*-,㦣󮖹_1M)&R;Kd\G!qIf [J>^&E@4E 4QށJ(4PzQE;QEPAb? #X~SK5\[wª&s4h3 [QG^j]0.?чUeH#2JUG$t xeM!q&oN@7F)n@/#\}O~uzusI8UX v3)E3u%$<ǷfSL6ͺ9Tε1X l~!;M #C:dR4]~N}:+ Fc9͜/ѻ`ަQRVfSepN ocbeя։RqJv6Ӌ8VUJFO3A8+QRd(`ګܭ',%oaUr$Mݳ+OIDE=>Ҷ*ʣsI_҄UՕQ ޹i6so𮈆)&Sְ%6Olc*:pMs܈f\vV6y l$\[67V ^YОN˙9BH;c~5r[]Fr6r=g*ŶU٥rZ2MP;ĖwԢ,_Br+oSvIe\=L}(Qf)G(4fNJym8\HpQC$MTbVoُ,yGVQf|FǶ?z{xNՉmn$mS:==7Sau5- ~}}j՛ZUv1ѱ wU qt9YT}>Bdka`zƐMgyK,q):>2p;;X\A#S-kt X|`Tt?p'{x&%Q==NH*`xsr-q,y(ܨmmXXeCqXV%[L |]HS=3@W_6F7` .52X܀ vV(*UI>Y0·)=[t*(YQސ F(/Ҋ(ړ/z(Gj; N[W6$_[X:f Ȏ+uN֪ZٝQΚz08iO:Fm>U,TfP?e k_Qp;Wv7v:4p^ggZX41U OzEUE40Xn$n|ۓ`gqsmOHzQ-")^G,0,TtZ0_%e% d7qPږX`DS[7siR}Z3b0Kz])vX?\;m.WgsfKΘ=̆9ssJ<#ȖN72+X` Dz]@Q⪥(Z@sZWrw1H4E3evsP%WǀimsU@;^O_63˷rzC4!+{{G9,nw ܜg+kXٔ`) JTH qEdo @vUҝ.&'5e(\ fİ) 8ȌJ]6>*QqG֊(%aGjzܲ[Y:kE^Cmmm1GW^}H~4VB#nsҶ`@SvmKqiJR*^*BvqEChFX (O[TDEMw]gJuX~(Xt*?Z YD]Bó'?4JY[]b&"6z3U#l> {s^520dVFk:+~ ]SnIٴĕ 4KkUB6#zK.!%@^ǁG?;7FnD46u5ou)KE&G 9B1ZÎj/Dg)r妾`@1Fxg#Nf۟jEVX /͘iv񹸻!~}vԶtvHS1Wʤbi)2h`kwwht+̞q,"_*rjMmc'G;]8` _NL6'>f 2Nn|J?Ǡ;ײ\J8c79aO5Qk̺1vG{;A+Y Aon-"L[)bN0~ORDO٤%-#99cjb?Jv)1@%-cǟ.13Z: fGzdn>^L 7% OqBrS.."Yg!P`=O6qn$X{VMrW-摚ـHy=zu efXG;AYGz㞱U]#L"~=ᚒ)$ӑ- &/fIjH࿇z2OB;?j 3 r]NぁiK8m*l:rJH^ZC8daun3rsme"xZo12԰Oc1SB?7@ӻg[jW?dn_n3sSjw/mapeb#p"Yr"@OS'bZQފ1H-JZ()QGZ4,1ZѩX}+[-6in3֭W/4g9Xzo&qj#rV=i= £}k3;QY:6ol D"$2I(% $ۄ}zY|PY$[P\B6n$,+-E;Y$_G54knb+Ѕ*tv9}7wq+F3(?Sޘ" ITe!AnAу\[G#"&4\wmGEԣFG"IwDS71J[5'Դfn"z&M@m5d?b=X8_ֱ5FKYO[phgELiH!yQGRVKz&+Hc9?4pj;eoͳP`_ӷbql15~'ĒeÌUE  ^+ A !^v||A=㦡GJ(XQE'jZ;E (1E;P1M@E_hQi6Qɪ4+眏?f)nLM@\ʜN8Ϳ&#Fq[0uaĂ\NrE<[֒Er m;0=DZ*fjposq׎ԙK|ʯ^ֳm h9I۩c-R[9XG0}hA8ߧrI[-|~TSDw.،f IsRS3[ ;$e UZ4ME%浓g'Og5x|/U=,Ͼм0l,;3E^[}K&A 6}Ȫ)2l#`sU['V"H7<6,A$dF`#5:*7` cIȓ/J@N,4_1GFE 2~IF; ژ9A<;d?7A 8T㠧ewF 4N53kH\lNsZ9mAFs>KkI3FCK02I34;DBꬒociJ1݌ϸT탟qZof,Rb\ p?QipFT1F T0Kp$@wЅvy8S]b!8~KuV0ȃq9rѠbB={k²Ƈn޵IFnᱲT?jдa[8PK!<袀#IlsWp0 CNy`I%Sz2~u edEmR2˫3; ym3ٓ۶?/JX{8/]%Gv{rd7S)'hL YUʓf GbGP;;؄ɗt \0{B٬H_~2nl ';]ӥ3B"z ^`U<`'J>3[=ckƍ2hc46vJ Rj̓cvC5ͺiH`; ڲnY I3GjC4w⒊)i;QHRwK(4uc[ݫNW>EoOǴ'ZѼm4 wq9A޹[4)X?yiӰ?1!TL"92ziźu?uz}F=*47JkUM.&8p1SԳJ=Nsa#u=BG+d>Ze1満*)--b(&v5QAwtmA"k d~t Q9#6nK(9Ȉ嘓an(KxS"E }h`bHMB~xXh 0:4rQua &ch(1P`tO8Z]@8AoV4D#X[0 uz|qք#DUϠ&XŭӥޫrطUo֟miy#O>&zQұFgk~_jU YI|eqUfiJJ3Mۿoܠ-fh"k!EڴI1NI< Gv4"dٺg\(z}3ۗݳ;U'җٵ9ŽU1s[]z=x֤&P*N-C1uNMIՍ\hCwR{ןxǏk-撶Oo/1@?ģr9A5ä~'&Rqcs`IDⶇKŃZJ# + Z'>i }¹4F"Hg.&q %QrB=RE4-NRԡЬyry  + HF"(x*A7*1Vg]\C;){wH;QF(b ֎g—_G#VA\ώW);c?Inw[DިD.o<:q3ta\oEJC ROA}jhhP2̧lOs= S>y;Hbn&ôK&G#c#C%`ƣ6IJı?,w@;AJײHmU&l'p2p2z`~c-%^QZJ(E/zC@D5-:oMcP>Veklkcn;g 7d{V1j05Vy؏z{ڤ3udW{)7?* ϙ"q4P9=ָhJ99Xă}::Thi7gp'UCIN.QJJZCLQKL+؎*ΧQ\[um$ xR4\ .oaʏ(]PvJǶݦ[3oU m92׃[*H Lrjx^6 j1&{v{C\ܝ89?!Q$~9#Re g]Jeqp@9U:UwJ=(mfB}1?U(iOL {V3 ;5 vVeûw8*$  zӀ^x:h?$8??_J1QVFU*JoCVf̯ċ$-p:$F/LyoTAs?4t^ 򏙹zpv@?۵ׅo(-xm9jX1Ns$H<T¦sy];Rմgʍqe>tžr;S~]`Ҥ'.=M{Hef` 9k6hgicɆ?{^Ko1)ދ6Yn>kk An8`(<;h(Qc 0ɻ%`QJjJKڊ)QE)z NEvKNR S_@X'œlEEh~gcɴnǦk71fd>[sޣ%&U (;S$E =z磚}fQٛ*èIY"m{rVԺ]ah1sEPފ\RRi(ژ-@ E) 3wyl?\ֵh N7wSUdɟA[JпJKS]Zկ -.~b<7~v{fة)viGQǒ{k+qijSS=9m݉KIKQG 1INb(PMV$ g&W## {` HaY^(PZyEU W,pzoI)ؤ5O}%LV1DYngLKUb5$B)2{ (D)$2 ݅͠bL `gߑQu]& B= ZM'a\E-6W}喣<))bFe-ۜj*O۶HKhsOz|c|5->WU_fo X]M u FM6KiVw 1 J9qomegjzs,Kyn=}2ifYfgFʦ>}mWgr.Ap4"4Hb`ʀIZE%j m2 MX/"tw]#qVAQERRIKU/Y% cDANIYQyme#߼돻sHuh"JBpþNzv`Q7 k9>woS tSL RظO =e_\T?A-B-׶ie5ʒV(pqT{im.nn!vv/ 0"-#Bo$lM Ui% 8?LҎh4f ( ( (GJ%.YsbhIyd@\#<+]+}OJӭ3ѐn"c#1V3_)h!ٝ!vΊhɎa*ks&Q?EZF5Hd$Y77CINI%KVKq~B8un{NqpJp~kߵBh ќz.,F B^_i41/Vs{<$%EӖk-)! z}*;Ϊ6rv} s\|E/#-$?ǧ5h, -#}2=0}M{osu<-|[9uŹ쥜c *;rzEhiJ>"-'F(4P: ZJZJZ:)=i{b i6zan?`Z6uX#sATΊDP)A2h"*SX>[p3ڷVu-fA,}!ީ67hGpF(qL(QE ;Ph(4PE>Q@((@Q@SF{QEJZ1GҀ ;GzA E9]AjCi]Lr@ #vP=It KM1N+Iw3fd+v@:qI\*O\9SYZ1,}E{e9an>sբZ3?^KsXo&Y XǠ뎵_N@o4xV3J%MZm}b`\ kDAqyqvG^2jfΝ:qj/,OͲEbr3nt?j[i]\-ˇfp8{ UV'o$20AztKM[d#'Q]Ggk5ħąŠ4,BdQI}BP[RgzW23#g.ֹKXd ,$blT|*#^ioaq#@lb5=N$ܳŨM&1v"wq P3'MUZkzKIKYY|# 9#9'k-O퓘V,SԃqPX;U$͖9TIEɽPk$O6!* #j[+ŻgSE<$C#{ծ~axctgU)ӨVHCJjRm;;sV!*rfk6ʹw+6*u9Lt#*FֽarZeB%Q~IµJ)(AwO l--(8ocֺわjڬ춨PݛTUؙ ?uhTU8)I>"k4R4N8r8VV\N#K1=E >'y`H9['13]=Z} E _u?FI^ g&c7v-gw$(4b3IKIHj\2' (xQu44”J;њu5/j;њNsGzAGPH:R tY#du =ǥfhJ,$g)F J֡Y$MhiEF!FDgW* /BGJrO_ZǾH.T>szR x hspe)Ac!cַ+r(pU>_H$`FzxK6x|c7nR*=:UiYcHԁrzu:@;a,3؎A2O\O N!Ǚ~q*ƍs,Z;ܭǎG9`>Q_φ 16q<=s]j*X(u+ F/z=)k˅{{`21^; j1fj*#fJP5~WLn]xyƭu1F:ުjaW@gdZq'{:qAhu)csJbCsN{Gƭhڣt[2I~$"`Ƙ ȥJ#vҨYCG=Dni9۽h7or^%P +9ɬw̚XeN~ABh')-M60;Rh;~tz1i)O“H -%~vw(PRZ;Z; pV2V’+6b(-%!KJ:Q@iRRށ5G Z˄5qT(@ ;Vs-I5iI+?牫>?Uȱozobb endstream endobj 44 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 1022 /Height 281 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 37361 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?|ghAkgƼYiFMRGZLԚ IJzEg1EF(E'z^+6ZgZ}q?~u5||cO1Gr'EhF((@ E-Fh uḻ:qH5;T7 g|r' bU+Z:Fї7[i<`;0;tee 0T" "69W!=E%ّ(>d!J7|sYm4[ym#g+po󱷉13P\j:r_jnBxفk5'eak͎cgc 7H.epO秷Zf'SaBK(;OQOb'Cc]&R2e)muo e .72e {(hCo 0Gִs$8#^+d0ҞhK1 a2 *"l mekDd;q@ƂLq|M%_ 3"891Y4rml0ܱ2EIo g *2åUΒ6Sp.;PG;GL vHs64T;rF@ nccV#9cuo<i_r^z u5M,A3OxٹOǽRDYŇ&A6yIi}>Ωs\ڄL<_.ݙROSZSx̔u":k B*"T jutۛHX{ ㌛9KK4S,BKVCd9DđD#E ;ڹiA5?nΔL:iIݙ݅( E!-%- ;QE JZYG=XAI]؎7GOW#BWHP}OKBٕpO: ހs0Ӭ_#;w9ޙ^"#\ώ?ny ǫo\xt&R6iAEIQSIGZ\PGG-%-'zP8b Qғ/4qUOYKl|}*YFLZıƱX] ,1F>Ì}qWlVdncVk:Kfk+krvI1r#jfҤYZK vzYS˟~Z'fa;QF9BIJ:Psql8tFKnH>hD}jO2Eul{~'/RŭzҠũ-233ԏ^Ny9!Ye<fXNR# ;^<]756BviD p)20A3O\F3kQִ8^JoXNd'#s<9R98Pn<ұȐӆCB}7t.DdpkOh`_Ԛ nsְMgquHZYm.o<iӽ*\L@Zy, r2@P32Gy駺H2)E<sZz%̗zEӜ[N#'Ak#EM+_Eๅ&;rThTYwbfh֒49& _ʓQ@袁QaGJ(KOz\P49%uE%i(=hQE =4PEPd4E ( (EPEPEPPCgm%̋QY>YY\$qfbpMr,PUtQ-&di+y?ԏW,ǝ :ڵݒ q+/CVa-/?1ZvMa)|QHw)#ႃnms IlSx,1 c$}+6V ~PcJmJnȦ8Վ`"ƁQ@X2;ic{/?${RY{(!jl-ǥRa&N ~Fң4푷wK)#ЦH5$^FhL z5t~hr=z?ҺvXpz%tscq!\8I=xZF݉风1rH+Y EP( Z4QIGjZϺRY$~~\DE3Hiyffv3G{Iw Q)}GSo ɦxLn=\ߏQ>3:|v3kR6AE"QHTKF8aJM%LRQ@(\RQފ(ZLQE2G=fC$r H?Oήս<1l*rzsV^Ec]xbUjẻ%c~O͡Esw: ry_9^3o[O <'FM4I@Z# ]V>w/zі3Q00: 45[٠QH}!k9|J{6ho Hk'zҸ qXJ%} F?Zw5%#}.{Kv3qҡ{Ty5Z))h J)i1LgŐygI*p?<1t R1S$fC#(B72JĴ1~g;O}Gr׎GΦ2$HJ?_j\[DE\y(oV+;RVD JɆ07:¬8m'9: y'gϭ;8Ҙ0;za wH 9'V&^_BGrSTb.rw/>$*2ђqCXө^Uj*RۆO1c| J3T9<-"2 "unyq95?$JxLZƗ!MoBHq"垣-֢9aLtr#=1t\Cvu{bgo={ֲf))GJQGj(EHQ@Ҋ`QEQތ)QEG\@(KH4RPGE( ;EQ ( (RQEKI@6II"(3=Ioof!:ϵsmy⻤o/1ڰc?{{P巫AF/Pׄz']J"jaT =)Ȋ*P1TK߱Y.<>һQ(w-+%]* -$*U~l}&ɣVwO)OaZ{v|}TW\cZYS"` Mu)AkeNO$ ⨉[6Jr\ǡ>J!n7m$\ub{1Sa*m7KKUy$!L@{H\TxKEϦNb!jTo:'JF-/ųN?U{J-/ܻؕ%I}qMSs"Ƶ|'l# t17zTt.;fc̳A* e+Q˿ubLon"Mhxvi BGX>0>f k#+ )* EVfaEuP(z҃:03sHo'54- km>9n'ǓLӢ;覮%-%32 YNF^9\?g|'2?CظUD0&X+= fJ,jۭ!oXT*'?f梭⤰IJ9 ))A@h4Q@x^((#޵U=F@<"o21?ؚDn˨[yvJq\0 ktea@Q۵)+{㧷5N(-F<ɞ+XsitV%h,ST8MF;H<=g]9]YÒysp*i#{vH!w`:Tck#%mz7?Οot5EսPg$t,C!06LnZ1f!EP!+#]ю"*ٳcЊؠPѕ8d0\q==t2Al7l4M)Fޣ:Vz^[^-#8я\uSr7YUJRkqk4N~IrNJeKH2F98̧ pqg+lu 0Ihd]?ryw:~Qv~lc4ɭLNjǑXZMiZ =*$UC\nt;g!L.8ni .Wx3PXYũYV>UuV<%:fő6FFsIҶy2ʬ? <'` pE=63:r](iG//%"L8'`GZ諙Z{xbMģkH1?zqVrlK@ZAiEbwR)hE0AGJ(Hu J=ih4f>w;ъQEwP h1EP4f'Q@v(_hzݭfF$ƌ~\wpX~#uԬ@SW:(MnSbi㵋|GsY2o81[z1 뗥T^a ca`SФ2+LkMۦqTW%\K <.{`rqVukaYe8${⥱O,Ērǩ'֖ݜ9;ӭtXV1܎OR}Y-3LsEt(f,U;NN!hJwY<_VaG `dA?IX{Vr5ƕ)Q77(_úmdkJ߮>q5%`Ns+N< +?S[@TAqIEaJy-Q@z((@hgv:ufm?Ӟ>@ Gz(@Q3@];RP@莟9>ڵLCG"e=Y4m >m1Ow$Ue,e# rzsP\Rݔ5Ks:޵"&d+rH. &q$'70)*^O^Sc&@daAS9Š ;h 7#88=bcSJ`aGbg)- JA=2Ń\?$Qǩ*V]).S ďia!YFT_'>"wI l$aJI9 @@m۔Z6Muw@W;y'ހ(ǥ1"H*Q¤J(i s`|d(v s˻^3ñ'5>Q$K6rp]8k2O)'pFP3o6eim +^/2xNU'#%ĉQ ADIwf/Ќ-GH$-;sE (HaGjCK@(@ ) )i;Rf )h0 P)3Kސ(QEw0\b(E=(EP@(4Q@Qր (Q@4QE'Q\\IcGguԛW;g\{;{Z[%ĝ٨n@ӸPxc䚥$hDCqC՘ݑx{Df$: m/qX̑U@١'-H K9#ttuvQEg(Q@ IEQERQ@-%(PKH;@48dsTfFڊ}4=XwwܟT5-^B b۞(.i[_ kyCx V+3%ēk{uXM-kՙ"ܸJ࿜ԞGs` })juWOlZik>'+1dWCޱ<%eq~ kr>A,HuCܥH(AG֊S@ {Rv4PvJ+[y'Ef=R;mR%K"|} 'C~CN8./L:֖:OSN#KPh)4 3F(4+63}~h-"Uy Vdw:|(k=]ÁN;%EU ޗF( ,G@0;(f2/dCq9cK/+˞;e@2~ߘy3J('ztr8A^4pܱȥĞquO >Q>:WN;\C5֦Gx%FKtԆd]nvv"uRp[pw]Vy`Ya8uSUo;iZ=m.+7.{$"Vܛ2R Υh( 8J%v >O+I[z30k;ط=uZ1E- PJ((TQ@/SZ^Q@)(4Y;@AM[mL;~BLspXԹ$ 4Ɵz;W?&Jl@TfkkF s!JvJ: =S ֱ$[UYDJt({XݤЉ_|Aӯ,N+q}zµbo+?HoV + f7 dd:Ek Ijj4 L?^oxnc, ){?oacȣ?ox~m]):h X[z2x?/t'9"տ !Qp9;|G~2)J?~%7qsfK?#A ,:C'dk>_ b^@yjW5Z[b PGHz SၙOb}jܞtRD%Xٰ'֑|Gpn-,v(猓&3v(c11hQ)Ցldѵ;H'JX?DK.YKĽ'c+s3DnnĊ9d\7<-j7Ka-c+Zmⴁ F**ZZ'9ʬU#R 7-E(Nh )i(ފy[4)<^vu.}5OVsoY3I۸ +W5zRw"DeXi w"5ũy"i vP69#ҩħsSҩjZZiu:}OsWw `I `ڥ bIz׼Sd\P(PQړPEP )M5.P|֓>G` VV-קX9r֯Shc ,bH=G6Y-d[k"ѿJ<޿֥JR)sJ$l0 _\Ko(HBLzѣ2tu;.Em$u){LOS"Gui2?\?/J 1pn<60f0VS)9ңA9TdԄs)<~u^#5ES2 );&pI&f>.(\ dKjɷ?J 4ciO\4a;p0 u="[R[ >qPy-VH.l. )&_@}=(]n)r99o+"5uhJ0ܣ˃VS)TDBK1zȵy-|Lbx730NN3]E`xJA>-74Qd=S@J߬`Fi ^(4QE⁅iiQޓ-0QGj{Yy1@ghk=s}Ƌ](b'&>u-X>O@7ڽ3yygk3N{~OGG}6?[ޕYG|''&hkoNLT!_6L{*tv!=Σ(utu ֺ}~*A@ZNԴQ@v ( EzSIHnAQ]i2Z3Azz4ҹ-ؙ%l-/Nq$`~Yͫ˛畷qƵB(U(A>V3sloZ;tQKLQ@Q@Q@ KGZ;PkZ;b#8C?ïR[$1FO&# In{=!IKJ!IJ(L)(PRE%BIr/ѩTr9PzҧC57>_D3B=Z}p'((+tm.[t w̄7NY=U4*84ӭB1>K~63%Ŭ pY`gsileq fB`pOl敬裆8U.w1Qɥ$5$TE ~IR04QE-QVzJT3XOEBs8EYB$Hن) *v8'Mule1[ۤyHWrsW-ibd(nFAOS2uin8< do$]@ 2;Ƌ1~olV& T8 fE;?1=VRzsk>ԇ2?T g 5U)E-h-n8ly!VIdIo L$H%FOԝi(Kގ􂁋EPIE.(:KI@CCt3i0axGà ޽RQ(SlIX1GzZBi (4P?ZJ\Euҁ٧y?Y"+J,sO|AVhs-1 KIE V4L?ǡ4S7RlNtj֪1?hA`H26i!Zܶ rc`xUʦYexKM]ܣ^gyAV LcKڊ;R☬%[#S~kP*jw*}:ԎuaUdD;#x4w6\\ ˴z{J B.ih\+ %CkV@e{y#s Ln]wN14f3xmo맑f- 0>c=yy=VIl~i)mrw OJ`X5=_LٲiWp@ʩꗗodm F&JrOEgoΠ|8!b)TEaeL<= \\+H9'Dڮi)i4pWz[{dF 9brOSE4Lf=ċw*!?¿~c4MZF@'ޯf$+et2-&i($.U5QӜ4dq+ƯREr T=*THb-9"rS ͳ-nEI=©EBAaPty29"f'$=V-;29u *+* fm[}Y!X)bg3{U( G-%UȓXyOY(5}BE(R8<#]u+WfEM!ï㌞C<0O Hş ZBG''<Z礸]J)g:fy)eW;#ߚtKYlkH.4r {]ƝkOqcpHvN³]4BZJC|;3NEY-+s*.8E V<)f:'jckOэITw7ţ>Կ뉭Xυ!LT"ӝ2ŸUU4&E[vJ( (EҎP0֓qKȠf{7WS_9]ی]:>](4-4&nkI!єO 75Gᮡuazח3N(^!º-e| 7(?֟Av_@#(v4(4Q>Rw}h@u=Mo)|:qú(o%Ίx!ʒTW7oZZVѴ?2囧'\YSTW7 ik4gdH]2pMH0NAH2FF:u]=Uds=ݖ8#iidE@<zsӚ-/E&$S4Ԇ=t#b]'n9j |U-&,WK#9c'$tؤ@1I@..-6 ;:2pGF"F: g4֔hF(8M9Ic[H$/_RTe_'Sd6>kE^s88E!P)H{dq 0UZfPvoKNBM]- X!XpH2UsVxZia6cU6$Ͼǻ!jt"FEZb+9OL;U_fןN:t;@*ߡLX~;cӠ' ѴSFk<ZHK?JԶ<ҕ=X7Wo%ʇA $gЭ^\p. bQj%敱utJ擉F1%,&gẶ;/Pd3T,%5+&HU/c?A4jȉj;OE\"ҪjR2Dc=U.+v\iAk~ŨXDAP@)Ե @aNdH87zy=qmb-Hr7lO3/$ju^s_*bږmKd`$BWvD(BJZAE요ШyY )TZё8TOef и9u-imgmJl<[vP\gӷ5B)Յm3rDXo9ϰFh:S#X ðQJa΅K>h{΀OΧ^ZH3LӴ E5㢮zyxWfRIH)M&((Q(= '{[<&R2AsX܏ʸ꧱CYxf i,q+zj))h;QAKHGsE Q<HXHkd}N1GzK 0DǮ<0Z=ΝO2]c3ĕnq AwDJ'%2hq 1n!n*E>5 Q2+!WpAY>S7$i#BrOZ٦dТI\w4PhKIG4E6T :$JuJk%o4I!6=k7>aW7U[h|%\8lg{V͕2BMrŜnFKN.W6AY FӃy?v*H w+s5͈Ғ= NVi(,\G/>ZԚh2L)%H.+u?\;P\MMu4Y8K˛hnZ![~wG 8#kbMHOA.tdz!au!nFv>Cmۢ[\Hc%*ppN}?:fb-&* O#Ib;N ̨L ?PwbÊnnbdJh4b2~k;=CvWp,[CH8z4۝jn,@szSX7N?%>Nj hz]Gw1jUgaxM&+h S qT V>k"T\L۟Ed({}:JC"_?ZH7h:E@zʇO7Wpxn?ڙ|9f5Oz!e?(t#Vda,oӧd/*%l_(y[ݻjE p (tTJȇ6S,RH.9\vz,Eb :UH?w4畏QIC~gгK I *{ }%z(B:PNq@JZ=*^\*)8ǀ?:EBY:_cjتq*Cȓ'#s4Rqv?JHQb8T"yS?OϓyXna{fWo|k&ЊhP8LQ8G^3EU&1ۄF $#COL1vhk<jG i K "{ Ђ<>0~t {t;7?P>A'٭ ;@2}+J9RU4%:P Imvg=3?. H{ALz KXj71ǒi1bU;dGpCNw{'˟OOut©Zv_Mr@MI{sKv HT_1)ְ}#HfI}w&E Q@GZ1/߻q?#f_\yjK;<ֳ*,\r}ү[W1~<©xfĞMI|@m}KDko{y0|AWjwљhf^<2<ҭQފ) SX $o X <7h{ΆkP5֍} u~f Phcjuޜ_cVax,–aKF(EEQEPEPE.):Z)J(4Ph(4bZ(i~]#>$5$  0ŸGZʽK:0D봀lPO-=Z5HǮFC}ڷ %R.)wi=0mN2ÎsJ6J֬YJ?hcE.Kyܥ+vVRpN2ovd8YhkQYi@" ev]nvlcA<4uS ,-ҐJhZ 'ҹ׻K-~{|!Sc׎k?k {0͎+~Y4|18HH)"E`G\d|ia C){Xcdѭdm`Nr?N+`x5JU?sUw;hb$9Ƶ(<.0>QMSQ<P1 )*=,W U$GeBx$ɮ"(ss?O !Xی#?ލU ɈMcݼ=:R9'q;r\bESJ3s]ђU sO0/~zNkӮKH/ I4Fȧ g;r b=ϭii%DSoIy#/8;C&GYť'oQI?lŴ֣{ w)$H3yz[uoʁ2+/I KيevyIi︎H!˩6ycJ]/:RM6%8k->Io& +[͌(j袡Kǒ =늒lޤRDr̰ݒ];RU&o?ST+lw*\GQFxASQ಑fcxZ*QRvcjD/]lAomۛm3SRP-K A!{0$?߳'Ƨb{ۤù#4~g c"9m^?ըIPfqguD~& ATP; [q_*I.%zOҝ^6Nv*J}+EDq=OL&3C|IsׯtY" zJ-( v9=ɏ̿:VnjOˠz L.Nq[Z+fx(U,q k{:G$`æ¶qB/>`$0cԃr]8'乞>9_`ޞMFpp1cמY)iq":G4zغM XG${c΀KK in\s('TZArt#BpOױjg[g 6نA;vz-bc%)i!i. W)lfpC7Cy gIwtqoTGoOƛdX+ܓ21>[@X&k-mŪ5kr#P<۴ˏ#~Ϧq#ZZЀMJ7/o؁l`Iz@-/z3E%6H@цk.Kk%&˸898tO`[g9pAe9c4t=UGR2쾷1.2'C?_cޯ R\17j2^*5;Salwϱ][~%K""\yðf 5FW\݄oϏ¤&(@3h&*u+Q(1oϾ on{8܀2I(ۓ+%GqW=ȩ;xV(,h0)$%INOUNN .o?#TSkw |gokeV0&=Mv.DZ- dgTh+KhcE#TL;uӥU溾<6ڐxv;w8SkrC CI H瑺=;Pi(Gq2E&nܯ/`OC֢Cu} K ??0O)klMgEn? (<ʒ%1?:}TuT)>~~s![A+>хΥupV,@~­^N-m&H4=0^(|Daܞhݔ" r̖n4aF0 TKXS Q4s"5f:(y.uu3f,Q [9,фW8UMҒ* JZJ` tz^XV=)as= -!YǁRvY?6qK_fF5tBaҡ[i1ʥ[ҦH >cKRNm O; מ^?Bo,Vfy瞘?NWGtX8̏9d_cG5𵮱ƛ4ZcaE]ڌs^X~+:jOZݴ騳dzJZZ珰[MG-}G[iY2=V1}Kzؘm`f}.o{?0߃`Dc?Uf⨰i{T?f @s wIuSd_z>u?Q`*ŢXCe%RϹٙbsL4(4J1ݓKg9\k~GM!@O)wieocl G\ԟz4QHbRьRE 6J1@="4CR=WK)ِ܌A'VͲBjr/vҧ$QIо!rb*b[){QE( e֯ Mxmp= WUu㠤4ص+o.OD;cqчUӯ9 !oQ0\XHǀjs.Hg2nH*Wo棵.FO7-B4Z5wL<7?9wzS⸤zSI\x䁴튚RKLm'xāq4bH\u( @x+/ޢK 3RqkhxM7q?xsbubF;ԻA'Q"3)sQOց60ri0G僑ߥ1W3F;rUK EwU_XT\lp9P|Nd42ʁ1Luܞ+>nbJ NCAr }T`suif"ys{ j֚H7Ql,|{xX:]䥦r\u7@}qZJ*=: fn.}XOUCss>zE%f1^ԙQ)IOS_>DW~>quoV "aB*}K샡O?^7dZ)3UeQ!1ڭI vMbߟ`ʊ> z4NM,Ib{U;V\􃰮Aߏ+BfLL?Wp=U+[SK?VuTdAUc>QEija r-EWLnbBc!!-O#zL }{n?ǀ?J nZ4cJ!rLfyG?Mg A2/!c;~c4Xح][[ "򾠃QVgwn;H}UբEw#|ix\҂tdE!Z%Ӽbb0zn< *nM?!Λ3booC'`>I֓4J*or7b$-T9 Oﺹ|lc'_7wI( O V *4UM-Q_+R7M2yDHPR~( :ڨm5R[8QiT>^>lM!hŠZJэk_8M? PcGHzR/om]s~?N ǍteQE 8-kڽDBwݰŜq;Ge^E>f+#?SsʏT?J:՛T§Nߏʽ'E|TpOy$?z.(9QΧ.w*Q1)\zckZhւo,R3..ddh^MQ[KiBđ0~WS?U=WWo$ xz~_Ew"Lݝ$pr~" ~+*+l?]Q ETV[#_n?O "s?/s? Ռb\,g#?#jKxEQ+\SjZ>\ =hP0/jN  _ZJ -'z(#4Z`Im<>i#' 1=ǽh&̭;_絁n HX~ߏXLN$=B7IN'ЂGZW){g `CzcZ'sFb1E8 ;lW:޾od=5Dm>v0L'T,_$tzbpH?ҷup:w?ˌ~D@'ӢwT筅.l9HG'S^[,3V&ZiqoyNpF9̩˕nvJTy?֐t瞃lzyE&'9vfO{4RƓnp9MU ,6T5{h6}?Mo61Do(_IS46qJz+C9dZ fˌdsQ R)b@ I>#kkㅱVsrOF:J-ii#^գ)H=S745Fc{vG=#W0jx:0z.?_2]\ŌH?Ʒ}w#Zq,kunT`[Ĺ6=hxLISITW 䖑W,f jNэP*9,Pq MtO/,dUt_]N E쿇&`\cu%jL|z z m{4,aH~dU`I܄l|8kG7j{NLL[bNZ{!lbl\llh^ݍYcUvrO>/j4vĢE1 X!l.#_}CبtԝNODz#\7*A]=s o2WQMRJZ;HbQKA{ъ^(@ KIKgiP3ˌ{v5A@5Ф(nBE2M[2b z;f).2.H۸u8?jQJ4Q@J1@4zKPEGK@ AE>Qڊ@QE(NC&mos$;#H[rlm.WBӰW. $t@G5M;\{_ Jáǧy[I4A)>iaՇ`Y#϶UbYX}AnV> }?Vl샜[ƶp#i"İj&VF`u]8IF-~K=]\nnXmT(A裶3Lt[{5Ks^--OǠi~VE׊4Ir.TP@ ~45#2708=ODpHbT62YxzGX֠:FuyaX =R ˫{}md (bKAd<ԒHr?:ݳ[x_B$T\q1ptEyrFH*>^T`^T3ϟ>` Z肪(fCvPW1V蠈ɭD/˙1Ϸ\Jil GVOrnM2Ho?ZB._1{QBRPIGj({3CnL\ݏjKxLB}*dVbYq{{(-7}89j`-M8 'cE%$r,F AR-%=h8bQE- [9ʅF+gIKiDEHԅ#0r=𮂊i&n5 kuwY1Ѐ{dsV(t*2B*}8e][?#RX_-$1ʇl1oCqRw21ifKүҶ6Pv};{W(SQ ^I_8JyBx6Z}ľtHKG1фf.?w)j K9ʗFPNH(xn8%AnV$*Qe`VrsƳrKWi UOqeԮjO<}bHN-"GGLաEéM!׷Iך]-X} vsh`z;gU ٦&!ے?A뚒U.gzz=+oq'Efv7%o܅R{ #O)T&DՁղ=_:qWm8*yoI$?A}NO,`'ڍ`ϝTAOOv/X-Huf=vrk[9%usQjzi-i+dd䌜隱\"f'm'nwJqQ'#~dT6ojd$ N?*K3;a O Pv[tW3 #qP2Xe &8*8nqU?~?:qp~Np:bwKnoe.VIJ(f88UQaP[yNdЉ_ ׷g? *[@ۀn$鞊;ԝb5GVOkkgp<ܲ1sgZ+^Iv]B:cno|5KG7co8#mWYP[H5ʱIvڧw4m\Z0Uʈ\g$QI{q"l碎}S[–cܟzF(5%&G.G)i* ˵!o44VIu!eG[Opz {ae(!PYE,F$NFG5޺X IRuZ-F#PpbA=H=/no5-7!^OsR H"P^]YlKpx&6)==^=;],2;MDi:YS ?LmPr0 [i!Hۑ$ \d;1FݎC].0c*Ijt3q lV섐xTrxmKAPA-Űӯ.2y8^4g9{KE kM'kt;c,2HpOM X. ` ǥXӱo-_Qj6W7FyDaFGՈ^w" n/Y+73w>;z=i2Bv(%w?S wOw?* ~cuZje3>h̏/'۞gJ_mHm-[/%[T˪7;f-x!LU$Nf\͚4eXby$8Di_.5v6gne#<ȍvBs)Y%*NYhbƏIt_ ZBL%.gsRI>:ꖿS*8($sl2a֬V?%zt118?,ڱEb_wQ ?%FS"A A rn788f|c—g.C`EjFGQK -rFFk'?Q ދIpOs`[?uMRwKsu#z̸:;}-)8%f ,f0Go xTm nG&k]@۫QaXW7 ? Z?S?ht 2hƗsnhX訮wDOAֿEfh]wm$oz~#E2;CgqOSJ]Nz\2X\.Zq`A2GŒm;WvBՙ`#ޝcW5 Uo {ŊOJ5<3~+C:j+U=<1IuPEIv?x_=<+qPSoHJuvBt HfB{c}r[A/rlxҏHo_G+4ia@ju4W-0 Ə  N5}ylqRƧan㽍VMQVMP}*dfYo pqYƧapt`>s{S^ftֶY[0dI$}I$6#<7}4o;=aq`Ѧb?K&~kS%ִ-_yh o9ijv4& m-2;L7m _ _'Z֪js"?֣އWME+1}D&t擵 Ng>+]G,h̙YOjC7M]?zZw %0h&V7x}GE,4x=z^\[񗦌?i^2to]U s"9GE+?zH+4~+s:w=G)?dG:C֮Š.8!0? 1a]%+?_^.?1C[WcIEƁđ+?{ĩ*(\&QqM?cE_yR~hWfUEœ߁QŗƊ.8o<T˿/ʻ S@]!ڹ?*OC5B9VgƊ qϊuTߞ(5Q@!O4wگ?]Ǐ˫49XgCR?[4uQý'v=3Mv[]U]ˏ&9KƔ|?ۿQIEY+sƗbIƺZZ.5s f?tQv9?']]Ϗxx2/ƗApgk~./ Qp~F)h #V/!ۢY? )k~lN,m*(Ɗ?e~+Z.kEM_xsF E+@/OhEB҇M2/Rb靴OW CHӇK _Ka>6®QE?/RgYtI@;Z~(-Sw4m_Ў|F"-?*u-}FKE&j\{R@ 1KI@b(PQKE b`&(-J( 1E-%Q@QH(EPQZ()hъZ((t}+FC^-4 endstream endobj 45 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 410 /Height 172 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 9884 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(Q@Q@W9AOΑO$DS(}i::J+ zS\R(tJ(*>%p=[]&yvgA1"uC[;;v谏CQ]hkqhpTGҸ <820}Eznx5xim#w$N<26X˪ܝKDnfYݘgj_愮#r=.t9Y#ة*CgLͼ;:[mA%E<\mR1(Z()h JZ()h()h LR@%-籥 ( ( ( ( ( (Š(AEPXބ͕7i53#Ҷh :mݤn޳4jG7.ƥwyeKiVxa~Nb x$!8\4osū]GHI*1jhRӖI]bD#bxJO(-Ԃ/T3t.3&=oIi]eF?ҫxrY\Zt+v[PVEZE0^,d0ZLz}_Oys}tSY.mQE(@QEQEQEQE0 ( (IK@Q@QLR@Q@Q@%-(((`ڍ\E`pP%Ctǣ Ҭ?Tt|#n?Oaպ)\/QK".cl.icX[p9:Wobi=.!V268Q"AKm=kV-*I3L*0:duknk?لY {X.u"a}VIYf%uH n8P7S.ϗu"Ln>,:z+^_aKI ܐ@ir@j;ZyvC⫯ѯd4{B$\^WmxyA>7k ЌR2V43%ĩ HGiM:0e9;ŊO@Zn$)w۷ֺ6wףO[k3"]}sHʬ3('~)Kp2y#\swZdB#錂H?QSGވg ۋL̆63,#T3$14nHIb8#%]ҮFW'ow.>rԏ;ͬY4Zь(:hmYy. I,r4!Ir6?ih.l=Gf#hy~Nݣ?JESKq,'߆?H63L;03"Q@XU0b?\TCL&Zlϯ֭@wx!VbrQ5!6mDPmtQ@LOmoN!4 D) G I>DTّXVH=:0-QEQEQERbXֵTV_f_jEw+AF+WiZũB66&L 4EQ>U4jq["\ ;UU y)z͹t{;sl3 ԑ:ԧV o G9\n昋U4$K HBu[y l2M/;NyZZ5XeVgziZ:o@럧sE-WHm g366kj-fE_,#?$k|"\|G#Qa\Ѣ_ӣDv#8xdu{]5N`U[ aX#rZIiNn[֧$1RFgDA$^"lCl31N8-,̑\ĭwKcI1P=z֧0,.bp|c}jDDB+RdcU;_ 'I"q=Ku8MI.}uhaQ`Ngmg6rҦOu)H4 .<mp8˭6Yn^/0\Oifܲr㎣EkǦ=2 !6p.sܜ@V;eG}i= b$>q*wʦ0qPE^–nNm]#hT r]M\FT[SNbF2NѴ'C6419?t2:u)\f hRyTZʒȃz|?pWUWkep?=-# T.44qfY'C]^z^4{/9"_T01*@89\5E+eMlΫ!L 96sfFE}s$3hQEsh#NX[[K8\ 9%QtҞ5wsiRRE%-Q@-%4PIEPEPEPQ) u RPuvkw-R>tJ 1.tc+ VQv #T|C?Tiu?W :]? ss+#&aVb6~c]Vxcp>Xf&k?SN[á%Yr1׃kfP f&yEТ- jdfghkoܼK[E˶gFO0K $]Ł#nONN b4ILY/0I=nӞO=cDF0"Fy-tKFGFr s)!!#+IgۂiQI98M̿ft`( <^=HW-%arNIrI|;mOg1,/UqѠ.LgI$3Ge N)op6jG }!Q@%-%Q@ Hii q贪;ⶵ QV D$(VgR}ߦ)96N"`f`1/_j 8!o*E]Ow3kΎIf |vo.ӬID'OkJօH-KMR+Gk>TɌ/# wUlY$1({h.x/`A' n]8bwzn%r"S&n&C@`>Lwq$Тm|ҺJw+NҤxYYVtK"4-<" guRҸwl:F4Eԕ[rK%)Gj^(IKE'jZ(wKE-%QKE%PRE ;Ȥ^[5!E\w&[cL=)|^ᑷ@=C1Z^N |ץ;JxD꺲iw"g8.%hIh\#0itaҤ]͌#;F\+'اfH38G Hf33}\^h_iEtQpVLcr)a\&\ǴaqI4v(Mc,c!U)>Mv;TgmӐ2LM:<[Y'v|N 壎^:`ƭI(@.\x 7"8dg nV%X9UZO)e+/=WQЍf|C'{ŜOo\y2~m$43̑SWde—\uq*KEmf&iƠR dziDn|'wo*w{lێ㿭- $~qykWaLr% H uI&Ym,V+Sm';0ЍCqޤu~ 9"h@'$9ϧwHe4x@I r0pyjei$Dgdh†~b $i. ejL@'9LÃl)b"VB@$Kn鑂z4V;5\"ȁF`FGR+>?C* L'6099jԺ{6laxO#7gU?$4I-\=Qc< @8RFÅYT1:s($X|&i%|JlmXӭE;.Yď,@ٔ/NT/<7%Fh9r0}CFjY^Ei]#Tik 5sjjCQA A֧jy@ZuJp3jNPpwuC\ȠM:^xo㑻7I?5? `jK%啔sI]3ڣ${t8k-Gbnp=FH#>MU266zd".j!$iey]Id|`Ϡ#㯭"H$ץV^$HLgp<2]{Q1ȡq++A^Wv*w{meC,qu?xEn7L 4hXg$өfo6Rl&uU'\`{sjwIbilL#Q!&gڱy$ oB dBVVŗ.v3@)Ga-*cB6 F9#@dʉKXu [_SFG\ΚeFI\F9kV47 nI* e q<zuk{oǺ,m WAp* ))>`3?^0xK-vHɑmvgD#a ڤlgrI2$OִGR)/&u`H BxdX`ɕ8#p9imλq5+pvF}:ݒo8АvJXx[ 2ʦ.pޟi_6LKH9#֣#YۢDOpeHT! `QjZֱ&똦6G?nCAlf&.Yry'ҍ2dEC#H3F- ZAKRVuƙ4O4f0֕Ӱd܏e'IZSadee]K~(ʸ=u)?&(V٬yGYTQH(aEPEPEPEQERRE%RQ@Q@-ne2ʌ\*?lE1?l4?oQp(cϺf EecV;Qc?hIA=(P)h)i)h((((RR endstream endobj 46 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 412 /Height 161 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 7350 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(((((((((@QEQEQEQEQI@ E0Xn 33E&sޖ ( ( ( ( (((J`-Q@Q@Q@Q@%-QEQEQ@Q@Q@QH((\8ʂvx@>_ʯT*ʼaH☗ % 8n?ߗe JH%Ob{'I]-i晇mGSUV4U%vEQ@Q@((((KI$)#W(w_TҎb0XcՓ2+J-oNůc|o_7 ܚٴᷕ?hjuLG4M92PFEI\+{qBkeĨ`nCVΝYjW (02B:ƀ.E5≧Bfh&/9\Ƞ._?"<5 <W>h`j }:LeBp9Y8aCn`|=8`:*uq7#HX$LD`UX+9uήmm_8"HO Zk"-{ԶUQT1֯62i{< ?r4wWrX6\yn`s8zf~ ݼSF_0?:,MEst֩}Ui_'py9= ~yq$,2mv6s\y<t٣5}1`JɌ~$Eko%Zrݞ1:ȰVhs2Lֶ8dYT>9׊}b 2]BJ8E[EghsJ.va,V!Q@Q@N5o R5s̜"]=zwqՕT0ʌFX!Qı0?jT휖nމo.D$o8iVCTk۟?t;hc_5J'? 5k[nEs8J҂! )Q3;rsͫ_\^Eg5=`LAk֐3G?F"D3c*^4g䘥x퀧8A[K-J Kvoxby HB7pZmhj$/3!a H4}nGu ΅VDYI9m1o$0(]?ʩXz(iZ(f! 55-[؉ʾte Xg#|F$ % .q⡃×-wO_o.%كnoLq)/s={y-B nn9p?:z?<$)3Q`~o֟.k,4ѬBg$ܨdsIk=Ok ߥbC>lvim{*cd:D-߻UZC(%1̇< N pہggEgG[Ep|p߇j+ZܛNܸH>;֢3_Dk2yVg>c G=ԣ(iW7J)!HZPmklH\Nn7;L6ҙqK89$*:ii"!bA$̞zc?ˉ)#G/3)$ Sk^`gKuINJ=28u^k sn ";$ Y$ن8#ke$ @S"Gp+LgSclY]̎ARXN]-ͭJѢHe8bd:5ɬ4.-yQd|ΪsM$ 0 [pIy:BA*}A@?s_e$# sg6Ӯ(/CR^]'ӭnZS< !ogrH5ZE0I [H/\'NcPmZ5ڋys0zӛVCwu5ҷ0Hk~KyV%c,~SIۓ_Od0?!N+CS/ex% :!!QE ( (,$@4*ſG)!;m=]cjxsYsY5n-wi۬V弳;XieDq\ coWwqT3xÚQF7;V =zaUZ|LomtJiHȡV?j pۦ?`tVFML&{fr5@O4v48Գ1Mn'ʸ#R=_ԭ>ߦZndlcO+3+08.yB&eIuN6p 'Q˭iLK{H>EcRAXGk${.8؀'9qR\i13ޤ>t_ΞmlqS`mqc`Ө[k{8Um&@߁:OhĶaqX pHO~Eٓ[ӢDwUp$8>ck/=hA?t=tvEuX.h%u Iw+Hދsqp&$F,GP#Ҭ{o 6{ֱt2+Tɻ>^ ;Sq Ɛ5uvkeRHi0 I' gjMFy/@dBϾ3Tn#4 {{+,c4#q sg>]V"4rBw89ƙu<_Irv7 jU[[y L!X0+m`G_֋ KDHh~FR܌qu\:VD)^V9&.c)e,O(c(EPEPEc,M9.cʧ4wTUY BYJSRԦlOR֧VUΫ0{K Cs,JRdy8Ob03c;U_O1y9ۿx}3RqЉb^22NE %uu-bXH3|&y:gZHdHn#HԶa.Ykvci=ĩ ³d@?Z6[\H4щ {py4X.lQH#Z@QE%-E׍dFG#)P Ṣsb r]-Q@\OcK YؖX{c:˷d 85wm 24l=4{qׂ[+,!brF 1GZXA,1F%,Vzx&7&eaTy<rq޵4?iց"XcYΗ sc9#>6z֞!_ Vyn% 2r1sx!E*g]*h4_.kYye*bˌ`tAkyd VpoN:Qhg1aI<,Xg@$ӎjMz{IHVMx?;Ԗ|ɅH%N FI8v)y%is48kuH%5Yfh& Lpi=$zamu'8]w)=4ڤy7<.IOoΗ#LcGs'wlj.iv̷Kl O > >> /Contents 48 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 48 0 obj << /Filter /FlateDecode /Length 2522 >> stream x\n6Wp^ [['bmd [Y^u3/ۿ9Xә^/_a˟/_>n?kua~wq1Lݐ nyuf%,cE_?boJ "3Wi.֤7?.sτן 2ǒa}9w9?vSv_N_7ĝhEŕDZt{zG$Ďst+5_:TdQ&2ftaQXa'LjM_AI$` h +wGM:5'W2c&DijҲē P5H߰Svl<2bBjrY0~6qiœ bqM #b;U\ٝIT-!t$kuH7j*IEIYqika: =/4IX)~zI KCvżv1 X0yRB%$ŋؐ0(B}3>t~Ⱥ06MNI؀s-3Ha"S߅Tf tWdZL9vVigvQ-Jar5vwWGX2Q嶬AifI -iKҋWQt32ِ2t3tخ}ȑ'.~t(AT&p,x\:cڧEʤ@OB *= k::I"1Æ-[;nGb9=G vc'EXD=bõng8& a6Sh@iǰ=Z$P<7uH SPK/tITjEo>0f胥8NT&(GltAg@>tP=O "Cq%eErŔHL6^Z(\V\Fh%rJ c9L٦t ~-6VU*lʗO࡟vV_ endstream endobj 49 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F1 552 0 R >> >> /Contents 50 0 R /Parent 536 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 50 0 obj << /Filter /FlateDecode /Length 2595 >> stream xn6_F$E}s$#q*Rw ?Ծ3Ɨk~Q0?o~1n^sqo߷mzՃVeOozQ:^Xq?j{Uc4q]ObZ(ِSKq}0]#cA)_"J7S݈7Jg¹B>?s- рxHVMsvlT,D*'v)048%A suی~cW=xYvg<Ȗ:r,^1"3.{H2D ڎ{h77ؘgw>~zw?meO^2Eю:bˉ[Zi#`l#9aox4`Ǥ#ΦWErL';kߐ'Q v@%xoҌ V xy] a>7}2Ήl&wD~2Z82m#^ /BeD6na%V1p2Q02Lg zO+Gb]e( Qri ^1M༞䨞MB={9aV\>$;ܰH\CN[PH©Ћ8q =ShV+{k*UBARg3n(qMXB8N-X$!\+zRI`F-a9kuWVE؀D$Im}aSWԇ,޾cpUMXw:CER`(`I V/u!"5M+͑hK<5flA%H*r!Ks!-|搜C?T(ɗDZeʎ6 NTP#dg2aͰPXaLԊs-TRWJz<@UWep(U>Vbʌ6895x"c:[%ZW"UglxPB}Z0 ؛oqЫbNھ*}j]?UHQh%RS^-X&H"}NUĹDʜw"",[HYps!/жޣ8 VI"C>IA 9:jD1WTqp kdEul8|O|UY\89NvpU|bkΟLNyWE|8=Br\GrG}L$Om:m$@/wO2!M)io+ 3a٫Y#ep:xg1M#Pe2 j `xV 9 HԪ=ŝqR(YE\4GRK%T)sLc!XJ+ ?xŇ EIBn;>T Y0q@CeNC6>'p,>,N /yUL'pKտ3WqD9R~; уO` v4:lt"F6Hc6.3]}Rǫqစ_ORe?ɽ+,]rU;˫\ȹ5*L&Xj(b%f1 +LvL5bqvKƂ`9bBfQ#Ѐk *n;m^ H=xo)CJQLh$WgYIiz//-ZCI ׻VACĻ7O߆1z Vǣ-bX쇲<$ȢD:ZNOʤq> >> /Contents 52 0 R /Parent 537 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 52 0 obj << /Filter /FlateDecode /Length 2583 >> stream x\n6 WiK@1LYERE{AngL8|8..ϋx p/\d^>B_zyGH}}r\Ҙ~\yxK[oޮ )O^>,r[,Fe>Hod\l{¼E͌8v沘 M~Ka|iR=hwO* o=|x趏)1n*oW!es @Jp)|CyŤUm*+AWP$T]ם7U'rՇ+S~RedEYe YDbyd$kE6xT^Uw9:Rݧ}OE`aK?L {:+fϓf%we/vBHO}GQ*k#² IR`x=LmхJ!)MۨTG;0iKue>sz3,s=n&Uv\Ő &.LJX>dQ.k)gw\A6cZZ κ&)EڕeMd!-suXx&cB-כ\r)!KNw8n4V6Ng0b +kEexƢwH%Ub$e[%,T ѨH+P\xi9;D2_n myCu0sD}X)?`ʰ tKau.̰IGZؤRrZpekR_J =KPi* ,ɫSbWJCKTS̽Sj Eqrq㘎 BBNa$?2I(4* AYf'4L,Ld6XHTY$S :gyhU`q2A1{w{}v'G;^7#0(xódUu!àL⍸V[d?/ϯTd endstream endobj 53 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R >> /XObject << /X8 55 0 R /X9 56 0 R /X10 57 0 R /X11 58 0 R /X12 59 0 R /X13 60 0 R >> >> /Contents 54 0 R /Parent 537 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 54 0 obj << /Filter /FlateDecode /Length 1493 >> stream xZKo6W$PصPmz* *R$53$%nJy}?>-saf_'+f阚~eY1:}~ /6{N.2Kmy""稄̚L+*m{;[ __ Y]xʭ2\?%ҧK<*2St%kN0k/3Q`9S%b4z=D+ ۇ  zSwšLH*EԚD|;"7;5aujj%dɏf$ѥ:2IOb #x(&{3OT4{%Yq/[Q0B gNmkN edNլa,0 DޭYx#TF*VIˁFMQpF9R|Nbki,h,h$;,݆gOZ˜n52Qg[sO5k Ƞ 晝4닪?_kp)A+P/ 'VQvTrʇUvÀF{7(oݳ${霼It NY?E0DfyCEkh0ʅ6c͖Q+&ش RWPf͡ 9`4E|&YF^hm!.G 2$7"|ǡMyCbCNVrђ'{?oS#!ҿP?ź32xq^g?]Qq7y2l{ /+ endstream endobj 55 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 952 /Height 118 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 13762 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEv" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( ( ( ( ( ( ( ( d JnH <[s8gq+ ppmIvx`6h)iQEQE((@QEQEQEUmBl-fR8X׫`+4tmC"Gs?1_=8=P6/>D7rJm *O;%3[!R6dt (((QEEQEQ@Q@ŠJ]@HϯUu eJ4$L*.2yڀ4hsEQEQEQEQEPzW7i=Ա4$[#`+9?J(QkCclҗ?ZO٢AOta3o?lQX`?5t}]տt٣5w6\u{r=3c4f}SSG#x:G}#g4c7uO ߱K_4)e 4ۺWXC| Cck>kzYYQb6ƥkӦ͝_n4mAg;2TR;Bk?zjk,>JA2$[v?o~*t[ dn<ݏ%yt) WS{nxE?ƹaCh\[def{jݕcM_׷z5j7H#AS:V?)IFGJKo@-u0V6m-|A 0d4dyVZΏ)jvaQB=ke+8Hd6SV>k'#>sG,!?Ə#e 5jz%Gr**M: (<|SqƗ2ivi?1K/O]ƶq]܃q? ,~Qp:'v_?Ɲō94)H>P 9l4wFfI͕2ZS؏rC)s eƔjv'5.~oǬKT Y=0dGpbI7'=N<4Ju}TID"|4ݵ\hvj^Oj7GnxSLgd"(ޢ?5/&Q9t|']O*r]3n:թʭM?A~h&?ƀ4(_AԻj)ۏ?캟boʓ캧!oʀ4hSn~êvm[P2Cջ^#O'V{g(BΑuHgU ٘jvv4: QEQE (d *HW9-sJf[é*pZDG`Ʃ `i tM),N7L I*#q[tm˱g4;U{ooGUoj`sjba8?擧4+`R12=*Ddsr&pUO kez+ ޳z%AGDZm(%{3$ U^CZR 9#^eT,yP]E0bhn6eS\^cuQP-lmd=Q֨Ir۰NA>ߊ@* 71ך^Fױ?_iJ\:w1^@A 3azԸ?Yie7|f\crI[=Qe[ݯٮnTz \g .d?@NOO;$.GZiBT&x8  c1Ic"0$ҍqG: (QEVGkVdxw<.O>֠BYɢ'cM9IxZkb i%Tc\ƅϨݑo'Yp>PPO/g7q<Dv8LJҠr׭e.3U$r1hi]iC+|#8a3F[Zo-nh YCh cyj0'їcpzՓq ZT=kBIC\y-oO]X㑌1[_|7֍<:}Gn%nrĎ@ui<pZ&! `5a\Zx~!.$}(HlHx4孴[7X_P@8Ruk=)o0+e_\RKdmUYrI#?sM-E¬r..&nHu~f!8m+>ˉcv?{< 1셩пk";B=s}?ZV5ԲȖ=~J7 #\ϙ*ލkR)TU`ː []NHfIW-^IėW0 Hgrs+H@1qZZ}jw7w0AUxb!QE!Q@ǴPi\i6?S]qk/T:_"u-G4s@Š9EPw=&;^)dVVWo9wЧ'ʐm giC<204"Z%ɽy܌ Ī  `?@) -쌰Xsʪߝ>T:`<zR)[8ϭ!窏ΤEKyKc 㓜gcE$EU/@?#8ϱAd~MCTخa!ׂV9?9߯>ԜSVfΜfl A 5Yx";bgia}EV!{i 1©,7Cip9d*߇`(SՖ"Zwd'ԼZ0?G.Iȶ zROŨ%ђ4rqڶ'0hP VI2 ؘΌEcdv84d!뚯uk~T񬋐Fzgs4#7ͻҜ-,dـsVRqWC/ x=}.}6Hd{5elRv>OzcJlK9>?8:z9ޮ[j[,njN}))`WGQkAqWAqA'xdA,W24StU VS ▐RPihP(=hh(E(P(QEE- ( (Y>|s'.s#[斎bQEejZ%]f_*jg$@<Ց2+ jR-V"lFq,~+ѢAI†>J)U{~cQ)| ¬Uw/hq麀'KGQEi;EPR Z״ P״ sߌ!k{X/ kkXxRMp'n[x- 3}jWQjUkNs_Ip]K:PqѲ\VQ8 H)1v; 翲u%bƂuwƤu@0I9ZjpM&7I$.agbvGwo4x˫yeF[]3Wڧ F߾ƓiuWd}˜>b$mo-Gœ|`ަзB۷8kO)yIl6ƮPGVdvR amF7ٲM Ol~h+z0È!a$n~Ul7$.n<Վ6bxIkRŠ(dW7-3Av?R^ǜ7i ),QEQE  (5 H t+yu<^0sxZ)RZC@$77+*u3]?"5亻2HEݒ:U9c#ӜP:v:w+bQfHPa+1\Khj׮Uqm'88_ƴr2Tmwծ,q^*ppywtnCN_4=:Ӂ? t<2M W?JϿ}OJ"V.wIRZZveme ('*);ض@da9CU-n ; $j{7e# S\^ؔ[R" O*l#Z^q_[LZ8gI#>SRr /$wu7(Q%q89桗FP[ߚ;A܏Zj]E ̩ ƞIO4yT@{*M"٭tȃ4l |4q׵)'~e{(o1̬pr j3jޱ.cd~"N) }N6c5 2 *@F:zd|r4[,e{w7>t˽McGvdẏ!|d{Q(p.1H=O4(\P!`S;9Mg$@t\9龞٧)O OzFGր33ތ|n2x4sPrGʀ-S1r@?J1 -h$@M<7˃QMnҗN)rA9` ֍@vO#8U gxr9?Px?ڵ p /QXdsFS4ƛGc ΛpRku5nUmoOCޮ54(XQIK@J((=Ef&yњ cEmOVkY_Q B: ((aEPEP ws#_ o@QEQE B}sA5^&?Ѹtp?N,16$G"q(¨ \KފJ3KE&hbKI1@5j?'jT5CM_)FIUI3g֙vI=)& zU%E%vYNz`Ԭgh`IW9EpOcBkn`,໒(ctõÁ ]s$"ꠐ'')x/5A9ax\wD1yΙIF>cO\we|+1B@qg\~X-)+]!Klӓ9r9Am6eew0FVDl NJ,;\R7WFr >8եDѮɽd\QECyS6T?:/X6TK,vx4QFhBih(Z3GzlB>&1@Hj+kuD#(dr<Դ$h佻0*ʥwrJPx$oв1k9' {NH9}& pzܜA=O^ԉ)Z[Xc%<C9z7xn"!= 3# j2Z WUZ1 ~pJtj@{MGUV$e;a9gTMVi$Y#p9Bf⼰0 lrmw-b3 %fٔ|#XwcuvWA<~MPr6 rdwLv,91vJ 䜖uވͮi{[ZLv3"qC5a6=EEa>nq<9G9#?[@>z ?ޝzfF!(<Қ3jE~Ϧ:;h;)2s?J>hU#tVO~9A|û{?ZCd7#ޚH ri ߟ=)YrX緩]i07pNq4qx~ 'Ƙ[8Fxz~n\Mۃң@?8?jlXp]}ku$Y2T 9=8U+mY3vR4ԃG5 wQ;!֖N}iq@ PGPzP(EP ȳ#[ fE ((ۨʕ?i1럸Y8uQHsXFGzqYd?Q3Y  I@(QE #bOjI5Tf-##C߽w <|ߓU(aEP (- )(h׼ P\A5|tYy5Gң*[*c;p)gҭQ!$SMf5jG㌎Ad{8U&a<>bF̒) 9 gW%isqw,sz/,R n@Je0Nq#Go1,$dq$J=>_֛k\8䷶<3o32>_~HQa\hBR.F˹EpX}oQ.-Xӆ ʁq'X.u-!#HA GZŠ(/4?o\Q Ǎs_@PzQ@Š(@b(03F(KL Rb~z ҤvPf 6<(O4 g3ݎt|~4|S3QqrouKKh=zkf XbF}f I8c!>~{;qHN!H>Ҟ3ps}k=5?5И I$߯]I{i' CJ)C,jr:o48y8?ʠPhnT:~嬛.AߠF[x?ym?!G}yTVvX,rIIMMwy?7?)T5kHS(B.43Hm%npiR8R%0G\5Ҥ pʮ1'S獤n`y΀E[4R$"O(s}9"[k;f+j?=oe^qqspWCvMp[ 4D_1Ίtչm#HԍFXD<'U=NJM`Gdo֭-kc(m*v8e/),rsNr%MrrɆ~p5zΰq$pn~}Zh78|?f.dWRXeqT6e9 + "{zƳcge1;pjU㵍4a9eY[ƕz j#"I} )Z՝0Adik͟,m WĜnc<1}]w 2::#*Z$Ag17BW8?J'?/B{ぞ??~a#΁S<9`H&JR21H Sw$4\9dg#>dqT4h11ɦ=}ISU x?N [CހvTJlBm.?(tŠ((AX0Q@EPK-AN ?w(HL(lZ3.2RÜjkes8?[{Ft̜AUYެw ) c6 Ğ`_˿jQ@Š((AEPQ@PEP s@wŠ(w% gXcb2SXG٥[^K11'$ܓEJhw"eIp: Ȋ2 8(`J1`AS^FG(Z0JQH Kpr!v#$&.lְȻnP((i?ɿ(?*( J(Q@(QEh Hh8eԮ1má=, QEC9P#ӡ>(b*lP7F1*(l@y>iI3(C ߟQL JSwnT+3K~Jgi 6 ԓܓ(+w#=)Ѧa*?ЏZ(^hO~y)ZW1v pDr/*Uö|I=W=榺uWOXp:*֬I9YVF#lq=>BIySczwBk;qp(z_[@ QhܸiOnc#˗G&{osg,S[2с{}QYmvvW< ҡ,Z($R= Zof>1]qetu1ELr2,,-f oZȾi +\\ǨLy&b*ۧQEvVGA5ry *}8j =(9=3O_Lꢊz.@8>QETHm(!N?"c/=7@"zgZ~svShH)I-zE ;O8zf)CFՔ{`K7hNwhfQL3Fh Z(qEQ@!E!Q@Š( endstream endobj 56 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 952 /Height 118 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 17576 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEv" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(Y*ysֽdxc@]ѯ@  B VmFsFE"(Y(X]>I$X,@5jA*,6[a8QSQ@K( ͒s۰TsM,4f=G5S6v6HPjZAҖE-_Uxt*:P3Zq$2JޜMgjzB^)b#FA$Tn?M=icXcQOsv- 8I$PwzhGWi2yw[>̛PP;ʲ(T>Z" D91Ͻ@Saq4k-m'<)ZGҩG"lLX _W9\,18 G4$ ކ'mקaW) Jv>Sou1ysqD>w5t-gU[I8pZL`==;uktP;^OcZ}:sb y}:L3Ci&Wvy;˕lu}?Z34~9BnbQ| z,o<=3]iȝvxՌH^ /KndnB9nhAkPm(s unyI&#[ /@6n |z/O?KW>m8mݗ߭lӡZSFͻy{{su-[x-2*$ҬiGvv!}:Cmn+)IW]NOOz}VqQ_j-^4СV8 :P7:1pQJT1gWG,RL->p'Hvzb*چxtHOVG{.H!Yl)5mjJRk'0G)xc NϽt1] G+J#03Pr>f~{R /^ p^(!;izfz-n2NbIsGn@ ǧzV8G4Q@Xfsc[~ 2NsJ v biJ49cJ01E<GLRޔ{t x'ki*y{K'lm-=1G+Vz(EQEQE(4Ŧ`Ţ)F?^*{U8`A m¦yL]COճҁ((( w@wM/E PgT Z`?U(W }M\Ɏ5RьPAo_ZWiEe-WhATQP=W(~ɪN/N.A[o T1`OS5OVu_F+?ձr&H_YZżY"ѳ1=+J3hJ(QE); (;w7Thk !H#I[x/˛XnAbASF}<ʆMz})H;#@ezE9 '*ڐ9svC=hM yq;N3XM[:/}:/LOڍ_cc{z.ka~d|u]:Z+K;r,ǿzSYd<[.$Q\ [Xzjvl;;qL5Y/y_RKt:N!w #ȫ斨c$bQ? j_%ee;pl 猞C-FI&Xlq H}8S4 aa0MSlop2_9J\wf}յȶҀHܒtdr2:jϰn58w70'b}GqoQ*%Qn, ZzZVza"`F@d~|ueEZ5,w0Kՠr?! r[ tuDfUMx3iIA3DrG*+ᕹ  0n9 œR/| u9 ?Ac?GhpO#7>\~$֖'`cH18h-Lړj͐AҝtC2OeMI\Ι}&&]*eA5w7-(RK@cEы[RF7ŒO4Zh:Q@Š( h40y0ʂcI?ZdM$&psgkW66F[X]&73w[dx_@P/jEJ?EVUdB1y>G5C̓&Qeq9=bC%l݌66ihhP (a (̓fJmڃX2}p?SY|%;˧mЀ0j%K$Ldޘii 1F(&(4QLPތVN[Ht fpsڀ59ZAG4Rgڌ) 7bX%16b?)w =E`r 񴶈OS^:=+uX24f0@(QEi;Hii)Qw;mdd? yqO0i_-Ic(h-8s=p64Tt-Riշd%5;J[ZCI,R_dPn#w'_UoQ-'cg3<=-Kɞ[yM:92֟`mK\?u> (m[ ٠3lgs'2c$1"U\ qdKIwby =oe)!7qrHUHόpNqZlOax = ?*`?m3E)Wc[$BT0CEku)Iy?u '+wJҤ_=HvA AzcpPvp0[_\wc кbEh 4dF?Z!Plc2.,߃ǧ:*?犹,[̨wz|83I^ORbRWe(.Ӥ s"񥐦 z˨aPeV@$ T_E *1E$NIsrD:ctsߎ?U =&;Z&nwaOЎjy ʊ{AZRPW^P~05-?ZPn5KNT!ۑV,Y#[S#҈2Nq>II'FTݱ_JMhD^i2ȑmC}eY~)Oj]cM3] lnOMj\,1[ l[ܠѩ?tgh==*ҲQjKspӜ< 8?4A ѳ YɂR!ֶ?y"J/.|9#-ז6!%SNX '{֍#IIArDNqsW--<ϝ^֛ijebΤ ɭz`ԡ •;vh= cAG=;{ӯO/\P3Akbh"$SoqǷzmv&N^L?J}UCJԑE0>vc:zJ Βs;jE[i wOJU AZh\]Ajkc'YsMHƧ#aqҘ[$`z$N;MH T8'?zLR)8;>zihp@9Jb1oALR?*''n12wdQR^8CtujvJxbӠ!è=x2;^CLqmb`NAEE,Ih`q 8] n9q#O}N))Q@tQEU ;Inbpv* 9\js>;td\2!wcЁ--x,a+q\$ Fڹ?SX(T:׵ۘ㷖xGvÜ( ͚Z1vݼD?Sau6E,d} "-y;OzӰM-x,_Z![cקsڏJ:%V,= 6yA^R>(~E<?G+ Ԇiq M1XfeclVUtE[v(Q()Q@Pc1GzZLQZJ`qjPU%Ls*L{>_A!$'88{vQu3,$8\zoO( G}]_gHC-ć :}:maczSvU 2[ᜒ@!U[&[V$V¨E^FMf0[c'˞ׂjIH+d;1类6% |rt.V4gFB]7ֶGs?.@=;ϵ.sz}n1 wArN(MGBaswyi{ +"$}_/^p%h--ɉ R CTyCߏOs6tǕohtAI= ׷mN^^!Khmc?a;u6VhPzq4(fp@%8md `J{qighḷ@|>Ynqs՞ir?gE[4ǜb8 _Ғ@~RmTqڐg1T契^<0;⦶9Py?4[[:+Ji~\4F7Վ !&|ļ`;;cNG3dH0U^JAN\ȫ,OxԿD'h$}2jZ-'G x<2~W/=:ڜ Sl?#ӏRuf>)=^T#eXYr$_B*?DfӜ*9(sc9FQ"2d:\i{J&׌(e\O<R&bHfM?D$Hmǰ7bL =r1Y'ԧf{ 2`aY$0k#5|q"<?M#iMC܉2 Ya㏦($]?LQ:SFG'jOO}2F}isߧ?4Eޘ4 &sOFp:c?ځ-d\uC2ȇ!k'Vxbr6?NzVh`ES 6䭚GO|[䦀P(0((_m~lQCj`lFEC*w]*aR,rTTW`Dzsu= d`zr !rG9HX{ 2MFl$Yf` Lp$}?@R\y@&ハ3zy4/1ܹ#]T?: FS=)=WwY|.cz{R0B1<4rG2Iʾ[''cn~ }2e) ۗ*F &z?7i=H_ȷ1&ACڳ/0-QLv񎿝SgrzrS\?}=j⃌5Mnq=sNlu0GG9! ;}4H$ҪcgRǧ? W?FF8"@' ?L*RGˌRg=)vH$)ryi=?=)cqEP u9dミ1.OOz.3/>o?NޮK gpGuH2"N.^4 V?? o69+bPNm`Q@Š(( ȹio XnFP9"ow8u?TVlrx :a:C%e:v VWA^Rh_޲0?h@}x?nH Hh%>tAT^ّYP3񤶕heǛczƀ%E~a%W2t޼z{coKy*lM9ē9=zeCpK(//;0H99FIw|<d;ÓQqرn|&m_5 W8޳mfӯ7B.ǯQP67q+Z]HpqONӵK{EPQ$$oUkkDٞ2L*TV#WC I#,r\ zבV-9dŹlpFF7E;@/YF1]Y#2y u-u/RCjc FAt=J@Z$Ln!,%YʫO ?Z枘-t1Ny>Ҁ4)SH3t0ۻ3q֚Ճ-”P8Gs{ۂ#6>t~0^\FnhL`@!Zcd}k;@?!h;Vn#.k3 `-yϭaoՊ^0u*Fk>-ۥ.J6v`aq iF/w21l$MwqLueo^ ?Sδq%hg |sߠ(ih^폥!UM`4ټH(HYPwT;.I] چlE`i4qf3OlW'\]k iވ~1*v3 5-f28OS4J5b{ rܪLz qpkI.ng,[ 3ڗ>d{ձ+akf%Q$#95b[T秵-Wz c$շˢ55Ɛ_%'KHٕB̟z8YHenA?LdӦغHFa6Ǫ9[߽q/gvLd䟘WbktwΟ%Lv03џS0MfIJZ}OV{XD ̙ǵSvԕi$'ҝ;Z%h|s/X5Ф%i+Cw<)+ſN8jcl'Bt]H!Vj\+4T&Εшc mH[ R@.IVHU9r2~Y#aOjբ]ƪQ 3BU}{˹r܁ _Fv&Ş7d`N Sr>θ[=`W &trGQaEuçl#ٞ8w4JpvO=}hc 8NH*?`} lZzGqN4t=1A=sғAqmAsp5scu-y|=Gt>-'&PRќ²Hۣ/5(sO*5=)VW'$mcT5f{q\L9YtqJG9qڧZ^?ڕt89^(b3=??RIj](`)4(@#=jx~t6=?p8 |Fl ~5m:H}1N.Eٝu-29Xף }hn'}䭊7!M(QH((`zv_XMFUcQV|lgz~rp0sui"O?t3,𬉜7b0G*ݘܘOf?mpb+#Ҥ%NU#OBѸ?GDa P&ᑆxːu PЃ)SrQ?wU;qe>4{h5kM-JjETg'9AM6c`p1;}@^7rԷd?t`;v?=ꅰUc9;;84ÿ-e٢U `Qs~٪nKkHC'79,M{9z#s}H[A|cyXTZܸ {k2_4 r7]Jad{E{d PHt$VrV_ Үv<612Qvqf" Qh7O_9DPLx$. W-c{(Fq?:f3+>CZjIwᗻiG%YpJ; ?յ5Ēݾ81jhbx|] ޛ~FT3RǠyvBؐ3Ona2p%te vrOt1D By8#Oҷ)(ژػ9(FIԓWhQE!4QE(KGz((EaEP!;wPŰ7Ө9K}ͶՌ϶+Jc?7tZZA/8qO{/vY.'ϱ>fUvrCc=qQK}uX$]aALެYho`CI T:t$%Ggp^HP688v^͎fW FULόp{gXRjV3^&$`~z}("FQ`8PO9ǨK<"&%8ڧAn鐶T?ʺ8+Dm.٥f̹+V7>gI1?T닔y K7+ ]O!L@9Zͧ\C"LJg=kMqfBbY$(C|7Q} _ ~ذ(ApGkB8Q\8 T:qB~VBp1̽jIcDf>c|Ʋn8vJ㕬Mk/ sz ݲGFC/}ys+)uZUCrۋ3r9g;S쎟c\͘.nc]JS2did*(k>]YͤLXT>vwH]}KAUA$OKܛgCՒP{UJ1gLһ[v^1ggqkkYes1ר ^V,iGmͩqHsdŲO\N7@RB}1y5ml-jTyTqzԽԒVGLgo"?2\*ȧ滫[-#q\ޔAX%H OgEdATQgl ߽=Wcݫ;Xkl #!qøhZ8$>x97).Ico$p/pjsM'SϧvFmֶ ,QAʖ\s\c \.zHÀ9)y;P#lLq?ؗ,!򑻀#wKHO->o8V܈#$X`kR"dXw`cw"3}V8ig{-I#]AT'3Ԟ_y5^9?%Q3ۅX,2x [@)3^CIԚ{7'f\]?D%uW?\ -ҶwAJ#8;g=:u\9%VR Uo/PBLS>~uo {[?33m-u4'lssƵךqkC:nG"=Jg=ť^8}0OиU,s;h3SO=<P)qސdBFyx&sFsONhJR~1zO~h 4+.^w ܚRO8zp)W% i8@@9^W>+fIGw7"2+Dmt?7mrVcx]#%[XL~c#\g%/Fnqx,FwAVKUm9 P1ӽFڭeYe` H*j(`,P48[,?O$2e"'g9QE|G%1;[>j*lq**&k7g''.p6W9\pA9?ϡ=#(T8WWMy1Š*:)AKq$:# KpKjƊ*Xc:cҊ(C{Ad1}(%C4c> /Length 22823 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEv" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(?N|5?k`5Ot)E@RQow&a܃֩q-EĦ{8=I#A¤iwKl OPj- &3 إIb{ӞkpG*êQ[E\WKV6H 1祷EJ:R0A<)3%)~tA JhNNb,Z(YXd0J!{qhst{VbwH"h:d`Z+]ag]:̠,Iz9eED{̓np{bf3"R1"wP=OJV:p 0=,UΊwد޷D=Pd{W2m4lvṞ[HTGH8di`F U+03pzgڣ7p]X4їß|d5 ng(lw-mdFSx!ZZu6q+x'Z-I U2o|c8ǥibGXfh&CRy# 2 9⸓ʙGA<Î楴^9G G>g󃫴SۥK9t9BK{(I g@ zSO s)}#A偏N ;bo7Rɻy* vmCvqyҦ`kjW?yk{'C&I ##bx)xvIo"xIC>u$IT20e=9['ms5ewGCqDZ0UбKXFQ<8bfnz@&9u (-%z^{M6 9<z!^g[!Wy:( A)Kc9}ҕ%@ =OiiT=X*,#G$K;rJp28p4қYe^4j$P4f^l\z|HbdwqE%ey:KNY @ Սfȵ|آIIUWd'S$y,(aRt-hViI![w668N9Wt{"#cdoƗv;r1Ӛ4+ħj֍iAC/zZȢ) ((CXcN"CX_M O(ȽU]"^7 D@?OC ve8dnGcXTN4 ͉ݴ=^wȐ+9V8~d{dL*w#á 8x$Y`f_10sЀ{h2= Q[i2&uS0Y~E_Fd޺ QE'4JzZ(/|#n:?RC *}'T9nN;VC&9>3WMheHOaIj',5YmnU.&w@nT]V4HAJR9ϮzU[ F%{;cɔ/+HG424,nt/\t*erEq6s :gӒ/F]n˔34ўapS lxMiKj-~"Jaa!QΨi=7 gNČּ]C͹-d:py?Ooq5s@@X(烒sפҜ]DU;K"6SdA0Mdh7wcK;Ck_:"0ܥ|q~+ ["Ie;pwY݌nz2^3!<_܌NU֑#fm遚v6I䊽mf\;ަ[@Y_֐՝T<Љp 1Jj\I%ʋթ[|-Y~g8G--Esf8c;RI=֮w;aʚsZƧbXZN` .1~AJ^;ngCV<߯Q 15\!mV4*E,Ca|TYSԓk(-d2 /#(hO?4pHi H8 })tS 8(s _S?1M4ޅ?߀OGx=?F ɲwj}?CYQL((%"\CXWLuTآ) +* s'ipH?\ ~^T([<"azsǧJJKGN?Jjʰ8Nr؅h..c1d#ijۂ%3*X Y6c&luۼT6sN{EtSw(AEvAEPs—RhJ[A'6kŬ @p{8aןT#eˑXN̚O6"Òs 9;. q%[]w9đW߀jW?3wBswwh/lMÔlv#8=ʼO1&9xRԴtɨMqk.- 'pLzjб[KF0*Ѓ>2=qEr~"-/."2?0G9,-fe-#d Qm潴I9C/bU=59c9's\EkX6`F#p~G\ymƬnbQRPӎ{L'L7(E-fB(RR$'̑‚W`bM+KUNى*1##KH\vA;s׌`WMڹmfM6e:a;}^FSWDsyI?纂d#A?)8+һg0pHȧ"8)k_N s(wSGҦJK}-p 'VlqMNq֗?Ҽib*I(id 8V6&Gk-==Oןj/#K Jx9$ /+dŨnk}}]t 5t!AsIGh/aҴt9dR#Rs2gO]Թ>Q@ FhW6$A%ƣ7q^g.?voA=Mҭ͆_5LFN 2OTF=H8f47ڈA9Y"SR'tlA'j%H PAo=(S w"_j6-bg JQ +`$ ,Oi}mܶoVo,4LNqxj&y%<<i8kqNEbCҏ&f?iOjM|C_43km#,`,aWz&#QH[]˘pHXG~+CB+m*a#JE_e`=s}Io3 ngCao@ZJ%Eb?xuVA?7GAIOcGQ xđ4ұ%!)y/b{ыSc4mgQռK|k<8}zPO5Ej- 1Y|'r1vN~kQQ p)lu҂{sW "I}$tb:>z~d%xi0׵1>"ƥnɌrNp#+RrjVȍѰb#h8ڮFultrpz[A)Bzc5A+B,27 `F=G?ʤ:$t%XP^?O<3Vu=‚3T2:SE$8@yM C~[Wx)e\2'zsT>?vE 1':x*AV꧸5\Ҵ6~R2}=zF Fē\,E9QH<>R7amڤ& q 0$L~BHU iaNIn*)7;"dէdA HoL1?ZZcCihVIAIaiAsߖ?j'eJS;?z-'4^ߨ029HdT"\ rIM$dCq}Ao*2ǷOU~yLҶԍw;ghOsro";S봜4cLl4^Ac#=k8&898q\gl zm oWr;Ξ@3A'#a ={QԑƜ~n3?3c$SMdwCG9@$5#߯?үN{{gzSg֘ ;Kb~a?P՜\tYsڪԸNtEYQEQEMdxOE]/V} OO(i )1F+'u4=Nt~Suw "uC\Vfz ]Z7UR2zw϶qOqﷄ<=P<dyn)P]+ %KPF5;tc- >WfZ5Q3@4(ۣ]Ia!%#'>Zk6_)AkSZ.6Z5A<~5N[9qB q4048aԴͤr2ʼFH6{zqu>`ђFq|2xc]S6c>8+vk{]j)b;Hl'LQ6˅[ 't^:VqE|3jⲣԌ(z'%ʁU?栻OGi,$FA˜q\lfڛXɓG1=sRc̪yCzNr4-I yvٕ})E')Z$}ÜqF}kd ro gw3q}=ȿ.?ލ3kR²N۰8qp8]ZĮk+]DM}ڧзg`?O֡5[28$֩b$Fx~63 1 Jm<+*Io@$]qi׶Ilsn iwN9s3j8U Kv41(GVK(QUC!7O01zFG:QE]Z4K4#tu9qu8+SVJ ;:ᄲ6#'=|u6*d6VzlK!dW9z*v2($b9xSc/>R!֔?jΟYZNDgQ i$Z4x,4˲$y|@b[\ϗgN1OaFMT:֩1Q@?Ǻ5bK/N㞋stJ;$tpە3ogQ5`i#ጱIA1qǩFԮ/c":R%0m`lZfCr ON+N!5ǖs<-.QӨcP]\$ #[G(In> jʤQO^1UOuoZ0H9cWk&ns>d}0xeBmD𥄑jh$w?,W3ط3CϦxAֻ9T'PT4]|A$ w^đc&%?L_hֺd^K2)(_(ȸl֡8}ecGyt*64h|?Z{ˋZ*g{y{.A^x=*5JG$)+)l\ᕈ?P^T+f ;.(jF 02sN,w1/$0(pEԫD2Z|Rnq@r*UUBQ:PUޗ}hf҃=]YBd;;zM4[B#NxW-SNx@cxu{ P"@P; R|Qo[Ӭq€z+[֯`_>U2@ suSX2LpUN71U-Dػ\E8>چjsǠx{J]E處WsZDqGj*I9MN_@fd?T>_{4xGR6ǩs \5-MY7 (=gX3QFs jH}GIBNHO~ԥr 9>NNsv3ש{U4St8-C)sJA`E-NxqJ;|?I #HF>^?nr7w՞d{ #Zkrz:QEg@QE(#VOF<-ײ*Փ[}+/+)ERJZ( 'ˎM_B:5zVy1c_>qVUvpS$qWG)*}G[O)M,:苆 a;[>XL&WqL7CkZVHׯ]1|MYbB(Z;8i~IUld.\!(FAYCUٰv$j$rg`FD=iGPРBbKv8A\˧ ;͖rrrHo^:6Auvv1#(v} dm8@@$! QsYTVW."mmiY2I }} baiZ#{lgW!I܁Vy޵ѐwP·m"[5 u)0Tv>Ƹ[4^qbZTB;*&ђ8>ק[O`+KL $1T8 T/qmJ&D;].c:HfxHI#aA1_ҸRgi^nbP#g}m]H#WR4sc=~4(6TV0CgdXA<*HSUe#)JdЬ㜫`?t dt{͟OIs]3|nAqm]t 29r#>ܗP99`.'"E0s~|yBk㷈h!2)*0vYO"PN7^Mt\E0qԆ?.ڼiKY+i,7%خ&6{z ;~QڸGNFaU22tqʾޱ%H%awQ6>/ t|g?y?iO^Q\> &~^h`Mri4FX2H[mQ]9soc{~5?E9 ^W$@zo{#+lg8)-N8d͟-~b{tVC52zEQGaYvXk$(mURi(q \՛hP?ZT$ﻐ`{-'ؐ?75VէUhnR9SF`r0H1Pbb>w տ+(2QEj=22w Ufx|&ER\Kybٖ!{i~]:j~?ziB6E@\ Rh\Ipx" WEE"Zؕ8]2Tej [CNS?-l*ׯ֩ghwrs\b(u7&V#-91qsVcRGڲIJTd<=`kpt;gj1萡m>~f~UA>97p9Ea3ɶ%|0> Ohayi&#yT3 gU XY\}}s#ΫJ1T+"Car=)_xHHه_юԝ8FDiD0!UXUA]N4>k"]Try4P:c=J겣G"+# Xd\ωnG-*@e<z7b:Ug7΀鞟ʲitu1IST.Ѵn%{dP_468Vp[ceqI\tsWg)XµKhikXsy(y^@VV&G$mmPkvy('?"$g=* o,g?B9ṷES5bM + $@>;1Zh{ү͡^~D!y7heP_붦$18P Qҗ*'x kK(e?w랕Я,&%m 9==tY"DGt`FaqKfMH7#98}*O2{8$~тOT|#ɐr'aG(8Ex(N֍4Tl%\եn< irAxPTZgA TI'AqiA0$ԏA\yG(r=F2sU{i/FAXFy<{iWztnZ;!EFEP ekCPyJIOvvF~a, :A/G߁mQqޝM2G*3;EQWz,,IWڤ[ST)*4(q5;qG@6h(a]_F+yZ@G;Ƴ wIsiqι4##0GOܻV_^3R<=,2ݩO'5l៥kMؙ#ze9S;]C +s0(Q@u ($`a=aZsQģddgH<ÜWOMtYeaw J_ưFopV`r2N1du=ZԣXUCI6 rdgOW%gۅ q#f\M^NNny5G̍bV4(xO0GWm'jʫqAˎ. ;ֵ-b"[hp~IJH׮zc+*ۢԵ6?JIQN_cpx&h"$`YPHH>;y: 3c!>sKd 9nM*N:'ڶ%9l opJҐ"-ӞkjuT&Ks]HznppD9W1iaS kӄ5tbB36>\ҝ!ՈBS`Kw'(A^Ӳ K*X)#?ZƽOU{"K{na'sWsv\nk{&U`]H;UO2f1cMW}K-Z -69˜WaK|,8Y aqHg+c?J#Ѹ[4(;TBhzڏ.حp7هq"5>px]c8.qҵQrpdܬ 2y:W\=O5Aԙu%fʿ'WUou -Ylg(WFK! `랙O7&UFIc#GkȷrI=I56yFԪ.eA#{j&L0:N8_˷wAƮrQBV23\1]?ZO0XD9(?5Nի ӮK2}GױVpcS޻w7 mYS(NmI|{4(F8TR+ӗnkwԌLΡiy䃌Rr_$Rv1#\߃Uu4*#Ƴȥ uT03݈A5 FzA+w&qkBX rdn5VhB瑒:P*d!_~T, < JyZBr?*.}&Hcb v=Q"IBR5wI,^kYnɌPkSsIH2)Pu$z5Kj*6?w*oC)h֨Ʈ$W.ὅr78CRoRͪAqt^I%$d6ϩvw>mIj=OCqREuS[cч‰21,FXu*H3P4 TPw緯X6g%@'ǧ݉Y3:e1?Nqڪh|6 սE1E h0GinpcfP"P|#,@9?^;xDq.ZJ}L'8ߟ[PSmn>yr_NźlAJuHlR?u1]|xZ\:y{$#-NQ{}m!OcCaPKR">rZE-4.m$i3TN "R<-<@ϩkdi&6Ppz:T`3M1{Eu]3QOILq 9>gC '^:z<FdcO#[WP[=̂8=P43PHe$pH~82GRRKIK[$r0aku+i`wE*uրh$zboZEY]'`sU5-Z4!9$fB<8(E)u ';l3e2|b^?û>L6ZY˨-$V F jAHq29e_9 ȬKf7mb֑6dpx}eR*MԚ2f)@O,nIjEk-{݇s^%QinsUsgϼkV΋\ OvlW=xz\^\F3Ƭ bXg)m}cBeua M?js*̓4RfKH hQF(+Ij\i-nr 㟺BJ) (d0X4ϲ[c`~5~-S;?,i_+Fi?ʳ3"Ε^@5(R03F){@+/VFWFBtǂƵ* Ť2ѻֆ^0zΗ֛r+xgl &WhO@}ATZRF;f6t\F"Drsw{ó]AǪո+;a)h4h9I|#63sX^C敞%8f+#۸YIjȘ"IkpK9[sv - 6'x: P»o>vx|~?V3USMF$;_^9Rn=IlڕS!K;y ;p{jƝ~.*yWpMzzj-B4ݰ~c&eX W mؤZjd$4rl0 qUoMa$lrG# j_$$L'#{cO}:Ina.c#r g9ktaFabzq#Jݭ6I :E#{fUݽJȬжu>⣽xDڃ9!Z!O:ĪʪG^Imؚ RhLgcT0"HQnNG$5k2A~l`w(sBVg%HĈUAy#lj-1AMthm 2rR0H99ʞ=#qV` r@'7+^W8!BD{X+I9ϵliStp0 }ѿCV,/sF%d"J zsy F8,= G}1^Cgsz9tim; ."8(r'j$v'::=}?#^&b2W2jQ_ި_OXvZWB 2gX]Xis DS3Zy"GhO-@c֭-$']7?5! dSc"H#w_{U+R ink (6q;>٪jqT%% cepۺgz"׮G^ؙVv2sj@'AU5-Zxgp= {:7t=S\$ӌYWl yV|+IӨ#?A-mc?}9sQ~R?J핲9xjXlx(xZ5۴'N6#*%hiq9nbG ~$~8~bNNʨj3[\ ^FFzr?Jghs-L€L{1~jrƩu*}֕ǦkyFʗ &ʆiઞyuUjI?N济[-xg1;8*8SɍQ8U; TqV]JFonĈQ~"7%ygdtCTXG &m7Gc,OkcO3UtTw~9uS.Q` fsQ_ Zu UxehYRgt$rQT.]b! #?et>r+5agh,_6Uܻg5;|zq;MM|cJցY^+!l.D̼=?1X~\]I+(ET\ g9CҺh DHv'& YdEJP)%tl_ qh\Cӌ~u>Z6_'o577m 7r3EќjKv:(?gV2IXVͥ|7:qt@ܾa >]x/*p*櫤F亮C+e#֋]xUN\[T9;x xn;fԚI#q$pp02GկDi{ž|H 8cw=OMմnԴ.=@9 m[D}*]j(fb< 87zhF) ((EsQ:WzE ( :(Š(AAQ@lv,zANH##4Q\^=)@ED3ޮLjkc_Ko6TO1&8cQEy=,;4jnFhlc+V=(r8d>G E`m4Z<{bޮ N`QƷ⻃?H/ ==?VԛSM^-=x&jPFFl`ܮǶyxBt>+ d r+˒hZ;5:#YF=~UoΪϽVr21}RSoRi8kp8(&)1t)Yj:zyGf+CGAEKb1+7Y{8Yw6p~6XX\Qq1u&m*#,2?w v2/bie.v P1{Nu%P' 2Ne?QHObƏ\V ~t'{ji_"\,:?ʹjZF:P78*{1(#Ԟ_sw0s:U/Y!y\h=;EC-N'Nī[qT2N< ^E6;=嬒4dUXJ6O|ڊ*Nyuns!B :QR#}cE O!d? =&1 ǵVmjXn2>VHn#wQ]QN(-fMs4ax񗈵 Q[7O%%d1:*6x[Ɨ;hc`緱EC.'ebQL(e Q<k^yu3aq6qWq8?J(e"g.47Ͳ;d[x<~XOV|2m(_vZ]O-- Dk3I5[Een3rII䓹iH${cƚI QE7ԓ;V:tB'U#֚c^O?(!SQI!NPK~9MHgފ*㱴((((ZZ((aX}h.J(lEQE? endstream endobj 58 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 952 /Height 118 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 24393 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEv" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(]ZM*@v<m?Zҿ/SsA8ފoʗ鞙 *r ufjrKpH[u 0OP{KQ e9#A>:]#2RH cy'}Ib8|jJȸ:4dcZ:+Ʋ>)6Hp ?.Z8WG*7݃'ϧH뚖$wnߕ?*9lDSLt#ttȭŠAK@Q@*o͆TY#rA  FkB2(KA2V]\Ig8CJgZ=bT}IO:C|$d;x~xJ5MT ֙|{2J28ڹNPܤ%5vL LqQҴzRViٌckLM ǫaN?lVj},пyL3(C꧸>i)O.PJKtq7g\<$Qhl!cjGGGJ7Fp.4Ȯf bw6rG_zy {t\q7i=:[Ũ]ysoS +v۟CNM Q-Wn$8®@9uj:<֐O;8gZҮt`P5xڲH~ x{ltehMે5\J9^}bas&)=sZ-7|G^׫o@GFcc4½YJPg%^M\ PCVLcVq^Bc;ᑇBcM7([20UxA?'NǾ3Mh2W3&VHRKYX#t2G#m `Gb+2+ipj n ?PkWeBP|ҕƍE#lR;J~[LmeP\Asƞs(kF@}$pc01uXQZjG(˖@7߯+=ZĈ*CH97N=KƦukg43BeFF:vUΒ7Xfsr~hd5[i,ǃ6g:λUF8>ض :,A*}jŕw3 71M*Dʸ@9(,Ckv82F2z2a)PE7N_xr+g`$rl՟ bow8-ƪ֭V =I;ǡY ajˆZube(NNӎ +,8P[ʳn- &X.'#VsӟJ;W-o@P9?ҜQ-=:g;9^'Y\d)XIU CSehդؤY:Z$o)j}9#x}G B2k}1߮jiF9cH̀Hǡ “K;g1:yI' OsZ:bFndlRq°mn&Br+ 1®ǠVuԗq@ov4 [ ?]ZYK; tW%qϧ$4;Y1WYUASV42eW^ki]7/B2+x;exثes:P|ֹxV\laE.N?=A37WIRE8t'i9ϧ]K˙~r=FjKQV2ZӒ~+K|'LY 2WR=Zܤ$p?JHϗ[0qd>i?E"bVdBp~4 kCB(L6-bypS~un#$KR)GPOl  =AMYvSP1}םk;HسnVTH'9$یu5KRhP{Yv>1QT72^J"B|3+!b1ߊ|>^Q@vf78MĦV7d'dnp:T?K~? 쬬xT`>Qw)JZ6rqO:U;k8ĊE. ʱ;Zf0޳4-} | /a}qXRF[z2[k/`[ A#ʤ뤀v}E{\I {T4ۗ;NFX~wT`v=%ftC֫NoE1oxED(ʾGqMߊEym"6 'F0~Z[d;F]98IHN.,Ȱ4s,`#_³?ҒEq+R沸bA?u?CڲgFuXp y6' #qhqvwh/.nyn8%WJڭzj4N"ˁ?U:PR^=}!Dxcֺm yCV& Z-jbwȪ:ͤc8F?]&\(9'ZHqyp7Jw*ppvc3 Sps <@3ze!y6ޜF8?( @3c wXi;A3Ȩ4;tZ!l БS_!HIJX PG9h?*X{C#9 RϧJ㞴/KMwnX3bQ`ǚv`Rvq-ZiK6p@?iM~UF>F zz55\('OZ3Gg"ذsR;aq#OUs1yxثR68iA9Qկ /ଣ]O?[LEьr 03ޱ㿾h3+Z<瓎ѕg^ ?W%3N(z=3OJ:u Hfe98Y<9'b( ^Ԯl"7E *`ɏFp~E);HnA>EQ@ckҒMckђdt) ((A}ͿUgz ~.*4Ӭ_:^G>H?Ҭfۏ SK9B8)W0Bv;Us?%̗'9^?^GhyI\kQſtnBr)/8@xR<@ cޜ:'"$@<go6IխD-@U;n>>+P9ax [\3۟KF}=H_Nbq6kiD:/T^\b% QHs߽3PHfcCВ2uer򪗼 g֡?$yũ(e 3ܷDH4|,d:nh6,I$jF caҬUkf,c +.N3laiɴ"I|9w-6L+@x׹MFs9bC[$zj99ޏ(!eeoJƲa J@Rm:{t.cڗN 2Y+ni ,zrO=T-ɧIfǒ]`~T-<؆2o`: }Ԏ;/!0<:s65Fq FS9G ƺSo-h]J8ӐGoS˦"=–*a%T KphI2Gg#Йcs Y]OPGSn-!#Rvp}榅#8*(P:{עlzˍ@9n9?i6q\N?j#;^f.)NˎkW[t/@|܀'Ok6;F?=Y1zՍhN =}j:|7H =pZ+5J-A 0rX=I$s1KlPHC9`28ҧ:z/.0p8sЏΕN68XPI9xhv99 ݙPw?jΗԝT]`H@p*p}0=G>.;N)Mfì]j}q[x{8}+X2,e<FF $T);Ɋ2A ұCO.7լ?}};ũ SbpWk:jI}Wp]Qd޸?cSy`G {n5G>9 ԖAG(7|8ˏu8ֶ~ˏVM .Lpcx݌n4"nw8.O;F)^AQ$Zznwێ4t+o:ٹ)ﻁG>ޕW뻾9nizIJΖ;YNWv#jjF0EVI$UdfQȠG*2-GSdG"@[kڍ8}ZUOvcO#*eef5\H+)VfCǂC`G=z&XN%/Vg xR1^vI%cxq3\썷JũDrlyŲb8$'?_ҦD80OtI4%xUI*[x rԓބFݬbQIm7$gUM $du C8R/m o@8(:\ZZG_~G;kV=F&X/s}W'χlO#zE[m:xB9Ue=--p"o2R7%yyǯX(16UxEs׷]3Ȥ ҌyZ+6i;sG&7m{'%z?G|ڸ+xQLIͱq}*??c:+;a%!PGoqFSG$I"H}!O<J흤&+>H~c\Qٱn,) ԞE'mv8=+/Gz*uA:5+[-2 ѐ +`+OAK zBlேPq $2d+.?V4@̿fm̿vqj%pA^LGiDH?S*+Kݎ(fKy~ܯ֤Q,h614,}a~?B+,YW A{P:~*?z,x1Uf(O*A@Z*㿵W-yb?>t6؜slcC}k7\MGNϵ CG*v6bOr2n3Y7Wڵ<"IWx =?#ұ47hs2ǰM##w?҃\gcrp@$ҰGQ'4֓7SHdzAMc җ< . zY?֗_ fKsۯ_}!R9$:~T~PJV@8=ܑ;Jƿ-NJcs?:}$vCNs$C~cNK!6tE]ny}*#'CnsRWt?F#N2*;h;tQہޜ%Ot0og֤`AEk NsǨ?LdMAŒdKO5ѳ; o9%ٻ793`YXZ m[Ll:R\_j0Zi=ɰ JG~ʄS3nƺ];ʑ8/mp5"(]̨c<]6=68#%9vz1" ˸C$=?ޣc0]D@1=s{TܣsYW7^ZETdn@5zOwZ=BEj% h6 !qU"-LyLphËWiN#U%.*p n{bdgvTFxs[V;[Jw)h+_BCI=⑳ztUZNN-K!gҴVY^|Sנ$ވntC]z8%zwj {+n~km+>o֓82Djdk:v[̒Fᶅ`qYvT RX e&<~f z$er>\-B+R8]-Vm4(ëka$S1?ˀe3K6v2G#yOA|U|Y>o8?U 46"LơU^K߭$Mm,iձSۓZS$ޤ8nbz> t >>v5NZ)EFInC$HK  ղi#BQ2uzQE (4PhQETpBBz§=(]/w; zd~5eq?~̦";_ MtWXźg@ROL`°ǝp&a9랯*籽;h:˼@gF>$4iṓs3Gπ8~ua"QklK1_AZʝYv1J.A+Ml`qc y? ^iJH*$y` P8 !!\r1G9EU@!9? HC/BTW)W:y7U%vw\,IxSL]*12U]Uk5hks(BJ* \o6J3-H'@we}:ug lF=F+ͧ7 RjǙ J[K1 sFZVw2)$hBSԜ-d ӱ&A =-n!ʕleaG5|Cǒ:PUxLg <0y@Fs\w"]0 T@A!BA<(gzc?TԖ RГ:Ws}1\^E-mr.wn3kY]X(Ի>2i:pw dd?!_#N ιt2 HrJ7`y>g׭;^|qI*;T ~?*լZuؒ[%e$XwQ .ŹSkͣЌ d37SI$ti LYzq:_q$7 3?>ԝ[sⓒ13$E 3t߭\xJn;}vwDʹ1/щP9۞8=9#Qf|ڦVP1qCh8UK%}.X;;,oKљDAR<:w}{Brn:uma,s9S&9Yb2B*6ڜm_>6pZУ?O9v#rϰ#4CF>\|qsI̞T0 *qttc+Ib`\?> 4ʊH[}8+f2Hį#& Ҩ9eX?:I\P(QK~Cvyڰ#֥9̷Nq`Ui:VA*,!)$ZҶ+D<,q(URaߑM,I<ߚctq??^J ?犝FQvϘp@pZ. [Ȫ185z)#I&j@\\ۻ;1hdf3}:ҘŬ@e)d;Nw\uOS6k 3HȪ qI)Q3S% A ,w$Hjv\:4H5X!T/#8b\zf^U@VGr6>=*l:{VfiNIbOo⫶vp3YJĮYN@ng񭠕;{C1hnU;aݥwCSiz掺홵X۸=gg3\=âI[δ-b[jo} v21?ҹmcII4,p8WPɪ%kfÂǧZ"JZCif,|}3)S kgSL?OάXZtwo:}sd _z׍ VL󵺊ǩ(a ɨiUL2F?ȞLܰ i:~Q*)l9EZXKܐ ސ[iBymBioN#Ƶr8ǧ~dpM`6 H$ jO0לI:RgO|f"9m`Mo"nhZmO q^3WQO,|HUfGClF,oNzztDZoA?Kգ}EPPQEQE.i(%{~ xOu.QޖeߡK`sFr=6Zjn"2d;Ҕ֌׏Hz:U!EcS^j4sb>T9b$g¥84W;ޠ/HGp ꗐP=&NOZ˕ IXZ8 ~HNH*SR}(9Trw`3s7<3鞝kJna(+RH#ʾlCY1 ?<~v}tSrٜg4Rbp Jԑi+\key133[ڮL+q >DZ5(*em v?Mr 0{{ <ƀ)ua-2@g ps>g%ہ*(AdgҷsF$cxAVLGgzֳ;4y?xHǿEsjZ=Bwt(2IpNZ8VĨʹ@#O4tD^6#xϧj6_8ufU>x}+,=$*FjzbU$(sLkڲ:)U[+!F9bN2s۟]󚂻9&?Iw PKm 7<`֤G&O̭TrmX킴lIJUpPMY2ݓ~Fm{Aq#Fr3µG~Dv꬧*@ уLUX$DIֱOn%F\%]-%ۀ3v*H>Xt](dh+b|V=j+[CR$áǧP}CTbuRNV&`+ÒOTqb)ne& iF&A2BG w8=kkLԭ`H~G%P6o @y-o!Or\[.Y(V0^p3p8k\].e΃ RϕYqpUJ6iQܼno-d2¬rAIrygKRhh;ޓ<:ROOJCApiN{ӈ ~hc56eqEg2]*u9{uJ i9P-nbKo"l8`4d g=x:ssk e%xQU ;Enm"ݝN[Ñ|B%.UrФDOxoph䓹3O#gf3jkr^yJ@#pG\p+V-&>1ޡLs =8Ke?Byk;eR~=aVm sqn8>?^|^πb֑O`TPI(Ƹ 8ҥB1ۦ(R6F2}SA֤˞9?Vf R) ~5ϵ n}?ژñM9E x\TKy^GWybxM ~V9ӏJC33!A+|.qOPE-ՑcU\瞟ONN)?S.`IG{w*r?~[]/0d}ε{ڝ#z5 sK#'EgdU (|Ƶ!M0={I*B:}~%1L2sK9 ColYWx ORj6_Xo !rGfO (YQ`XzgpšB篭kEio6 &5y{c5JYANA # _]i,1tг#Pܤr=:bɬBfω0ٻO\z~Sb:lsM/b6鎻j(.L<ϰ?A}+r$y+[# ̾`9"iZ_ݘ5U1Cc$`Gґa@ꨁB˷y866V1#W=1Ҟ;z[v{g$}OAX j::--(FsքMXڷ4/Dl6! ^f(0((OVEphxK^M3D9t[# !FiNQHb@85m\1$I"H6d{Ҷk-+v1 |*G99'<~ []d!$峴g!j#'qEo|*2HW6٪(KEf H$xުL!/>Rt5u1u`oY;D[ϧڅw=9j/ yR)4Nca\7mf;*=A4,2VϿ@?*|QYP(3Ŝ\yw;y yYM倊K8 Q[D(cۇkԴ}VȺRT0ueb:2Њ-&d5xt&hF7m<)c5[Egi厹XHGm,QHjFVhww_9Za@^WxnB"6#9+EZ!mh4\gY5Y.^>ZƘ-1(YD79?jܕ$G'4SEg (&cޥIȃd}R,g(~ey_"3K'}x繧40pEV1>L'$cGZ$'$IG2? WUShPVr]l&H>c@;bm5a~Sk#3T7 L+`yU850S ݸ? ӵ.k;H'I?&6 #X_=fCG.Zh֒ 7&`Ln4@Y2n` :~X_0<֭0w qo:^D$66GdsWMZ*qs(Tqzڇa Xb0)=ְp}xn,OofV?x}z8/j"\G#]c'ǎ?/Zj*RS]4|Gp1Ԯ{~U$ V.Zy(~$~#`2I-"[ƒ.qʜ`fb:cV?+{$BGVir;tsuFrk*:KJz^vǿHNx5:RZ^zU=Jkؖ6 pvzOh QM,:H2AOxO@PmbGQ.Y%vN;Ӟa($)#QlV\Ptʹq*QMgY/-"uޒJC'kMu9>"hG/j AMJ6אe]] =Aj348+p?0Czu^pz֧8~+FEcJ5woJ-)(q֧}FY57`dBK@XVY 5mov>5-ja.ꘔZF-e{:cں2*{ux>k%8/}f=ǝ#H~{/`[J!?|??@9Js?٥$`;Ot?5?4?Jv} NM&rH v?c=)A$8ϥ8 ϭ==3wx$|#$}l w?s߭9ZB9;c</ip1Ǿ xZN?ڜXp?Jn0CKcg)YpAvzNqoք[k($t_VdDteVHj`d}J%jO * |CGPj’?U,K1smw<0~ʁDzAlmdAgovd?!Uȸ[MB/7 c?Z#Cc#H~8rϾµⳬOSeATt6Vu^hnfopF7Ȝ{|ZLu"4A [p⺙vJ˝C][=]ȱd'8$cWȆZK Ƒ@2Z\ NE$.$e85 Gȶy[QOEouotb\$GQk%bY,-0aP?:m[%ۘnMP@ y_^FZ4rܣGz-m O>0H9FO.U *˙i#; eܘ$Jk奶ǘ }ꇅ]4~s O59eFܦyu=qM(bFi lwa(EIf`bA 9k&[cQ)XS3vBsHCdw?jݜRm Rps uQx@.ar"T9NH`ۧt@w;casBG-''ZvV&BwUE;1[$(ߟ}+wGL\7 _Ov*)3Ld`A #'zqֶ"+cj'vE5lOS@͊(Š((E-c@'j "W2nȎQ=bX\FeyIoV|ˬ&(;JI>Rn$)Pdcij(6K~o$dF:֢4I,f缸)pfGEM&kӮ'.,b cp\=zuRKI|m$c!F֊)+S]@;¡/*`vS Urtta|Y.G$zt2{o_Ai:%ÂeCd+_)u16^h&Trp(h Ӟڧ/P1]s(W:hՔYFROסK'X\[m9R})4pڏ9hqM,zyϨ?aE8 1f:p&*@E 2㷧?E; @ϯ'N(P(sNn{QE+߯O_*SgwUޮ=ȥ_Š)y}} qj(a3qZ]#ߎR. &u8>Ƴ $+\8"={E[lPgSZddQyS81Y0h1Bͬq3E!ì.ToN 9+o3JYeY\g~q逢(lw4roVgب?:ܱ>UvŠ([͔DBz*J1([D58>`>Z ^]&cO-T$QaBOEQդij= m,Yܨܙګ^^3Dd7Y 9N e( 0 GQd+vQEQ%)tKD8MۚysE֧ oP1ԃozM?E '9<ANCEE:\+6n2L=8~ºVchl-QL}SC E3b(0( endstream endobj 59 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 952 /Height 118 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 20688 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEv" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(_׼ ҿe\AoO o.Dn܍OzN]n&Dct5f9c7F"|IA$Qˍ+Z".̙;buԮՈr\JU-^ ziW #iXsZĐ*Փr̚.7^yⳭ(8.k-sm '6@gnF3 ]OGIʮ>2kA,K"a4\*R[H#QG8gl76}O%n+{[I&-C}Ű['voGi\(aSD7[hz0q .b'KQMn$ä3o9l:q_X^01ON":lRܟ/Ziu`gZV7Rk0 䃒rP~K'Dh>1V˅X@'?ٖ~D1А{9ٸen|vf!# d+sPZY&sɧX|BCgh8᷒Y`HRC{`c9U;8Szh$J o2ce {S`[T(x3Rf2HA=8 E5GU&77lg\\RIwFJWߞN1޴tL(ԂPEx{k (GcE]-^RF$q ZM*F?vFwm?1*s֥u*`ڦybcid HUIސc_Jֆ&lҦ̖?Z}?K%hU2(U㊻֠$ՄJ6smGrOC9qaQr":mhʅzP[xoJI$!ՔqZxhIdq6It9{Fq8za{%Uvs`uV-BAgJKYvk#gҜ[w)K]E8BnNw8?JË+dIs`qW3דw\f48k1<[svGzs\~CX{\BI'5eԕG%.."n 4tg"&Ѕ~:.e݂n\Yt-ggjfzT<kgD2ɈW۞T{ҭ SvfƢ:#کa2ghR|UH`3$dضc'SiWa-2C{njCud),mʐAޠMk0,B #@5ͫu'm?%?Z>^ +;vPzd|F;)bd@hMbxZ"sO؁]<";91-78&'X&]ʥs0Eb:]#}KI9sd\G޷7e wW+A򔷖%ܓ1B+c_XèDu$+nWk! kv纐G\8#-a= 2VEs;QCQTo'9gJH܀nLx5ՑW{:{K("KvϖF>Me=[lb2g0yR^iqʷ1tö^m#:8ܝr~QLuQie\.T%v3''$&-X6~#C>c, ׯ<~pߒC 2֗:R-qn9kW9`?cJZ hx隯gbpá#YPO\h#jz aqۊEF}h>ʟ<~?7Z8vqKONGZL}H+= F~Fr3ʌ)N3`ҕ☄#ЎBOO{?JROQIbTSQ(: C 1K:>(# ?:^:T `Na^ 4c=AtIN`S9Uf;T/rHR`JI+ϯIc$}[9lXRJ"s?BӫҶY׆ShׅI1+UVr;O鏈`  @™ +,y)I:h+S,c0hMS@͊(Š(w .ϝlqׅqXF>D F+}[k?y?N?i\SAu5摩F*Jp=KNe)>SIV<I'q8rxhR{R*ǩ$ m` gXFraFB$rLm#Ċty_SK!hY3|q|ցI >0ˎ>22F "I$@NNdW63;Ha}]JK/v=>*S[E)>#T94rwo0GK$i("+\0"̮MiJKH4K]H-3Ynn08S94I,YFV(pWmyOElB%lL3 ҫYiY)i_?=ۍN8$1o+/ _Ěڜ}})>gdV9?~[دc$!g`ӥB86mI4`rvV+}{G pBTnW/3l8^)81@I^BیkCH_^;>Sc o6fʯ3AVjmU|j$ ^hh Xmd@0[ ľS͙݌d(IEwUF?f, ǧZMDdpX`ހ02X +J4IFןP0x*L.&Q+;24% 6z,k+].ڶ7z7SjskIj+t 4d{^u1R R+"ߓ+8< $TZcDfb (_;S'vCZ?5+&>AwШN﹅HJƉٜj#4 )Fl3js4h0N6d<EJl#d:X- 8ʔ *C ?ώ$qIS?ɯ>iTv:Z1cڌpEea+~6G=ܿ ;1{뷪?b좽cӧNFAE{JǦ>׿8FJa7t>i!}9 놋&qqۍkk-JȒ7dds~Ȳʡq+ ϭhjQ4C;lp2?y0j;OgO(鐝!fPNҭN 22O:LQqsǰU>}3}}$GP9}Gz׷T'WF#XrQ'z(3n4K[53ŀQd7- y\VNb$HaX;I*͜J<љyG* !4c}$RN}HciIܞl{V(7:a!᳉VV>X$7Brxu>Z3]XC 'ߏJHh:u=TVKwVB# 8#51# Z,m@̼p}Ai"NE1nPa]|tYNxWp1Li [{8dY3iܒ=5mF:s}:[7Yߴf!zի-FdPο~F}{(wGO\ܣ1)-#uq4Riq!H}FVW\p9JԴɮd/h&0Ŕѻ"WH2e/K$B ϽfZė GhpO.mLC Ѯ=TG^X9zi"JDpܫ?OS{=k4h+pm!9qַaY3JdqӀZOJPsTkA(%c'8'NXB^qK})O| 8?+Ae)k&|?a88 1qP x<$|ӸѕuLf-ij[b V@ۀ(;c>u,AVI?Ft'v-ov4,fk"WQ#Y qQ2+ #'9':x`A&yOǷҔ {R`:R 0_F#r8SPj]iE}ůEU qIGA>ʓBV2=p_j͓OixT'2ZqWmktsO:'`,:4ݼJ *nO_43,[n;{N:^X#SAa 4Ա^Lh"Ag\۞}+z 4ϛ@B6;g:حa[k+VaE TQ}iQbSooYkm͋ " ~@X>%?j'i իy|HVvpqO 'r䑜s՟WLu5Z'%uE%P2|4Qqzf#׷ZK[Vʉ$@sMM+~^=k&srƴt+8%VsJ(?) 9U9oWYO w_.4ڡ~PRE_S3P'{#\Ibz`4b{F1݄^A'>Z̳Fr}3^U{$BF_;:P)$(y 4 ۢ) (գ[4Ha#p8RG}mBp[v ? '>-"ƅ״ i)"ivI<q7\^&m\ : `%!1*L$@mO~2+"+BfIY"eA9jy%At`öKOȐC͜26)s߾jJ̯pvArԂNr&v)>[r*$JqN~S~vߐ.$ciirKxnaInU(XȨZTq8L''zU 8V&!S65qKP^S3a§=A|sZ}I#Jϳ6 y$dߓ5|nbfS9|6"W*α[mbA2ys`Fr9${bqc%VYN*F<ѲR<}y={j$eB.TT#7 rSRMa,m!Eu,bS*֥j hd>Z "N{UTeC& "ꔜO\3-.=AEi7?7TP# oo*T[ujPphRv"ZZH /cYQadqn@zeǍt&g.տ]{h#nN2)Sڪ\m*ᙈR{Ued\p zȯ'bzWֺJSSѵHd7r]%ϘLfuWI,XP\&2_x~bOeF[VE| JK)ܲt@DjvȽ?☍]Nf w:T##㊷\HER\@VդWxX U@ 8'GMi/ ~p0އg.%ӷ^^$Ф`v`+UՀ*Ad޹}m@LcLrjokipc*;$m]2ƎVg 89{EsGfv1\ռu2Im((.6 KC#!?R{EcjV$7 !,3sG!2J{xUܲOs!'9rAB1L.eBL`Sph_ҴW]˂9QXĨRD0R ΘYD96Otz|ʌp7vR-Yhn%gƲ,o⾌ZTj1MuN9!OoF&p?= 1~?gҪր?@9ns > ݳBLcП~#i<Pg@T z eHy\))0}ާΔ[z頀z~42zb:X:e ,2p8,7ajfVǿ +'PKmJ+vvXH,TLzCE* emBwU [j=YOB:qXԯ%c]d)=ws3sJD:秿Uw;nWqN1{Q˺.og |"fw9Yty-!x+Gs!*ѹ c#+6P>Ql5&;zT6pYtڤ䓒y>ccVjc]=ztr==jWಞްmewG9*pyZ+G8i]S鞿O]>h꿼MqC`~&~h B[)@OB2u4Qq''֟EA(ǣ}'ElV>#6(QE ((kh:{IA5A5b<-*}԰j.T,w1D%`Cu8,}^E pؑPu1"lW#zP闲Eli22dά]C7Mfʬ`402`y#,Yw.{Jle(Uz1"EDF*YK4[e +b>Q֍V[Xr]EI$m= (a1p>e;:zf(h1y|߇R K}I? \&9i+SSj)*.*ٞE2a<$tQ溈F^ehPZz-ӂ?g ڌ8H@1qW 1܄ܢsK26F:aW=Xn" ćVzz*^\*\U HAo"X.ΉY{~5?nrP0_L֦TP`ʅ󩫒vZɶj^f 2z8?@d"U#gv3֭˿>`wвs?meQV-=̖i)]nd#>5jYI,NU}¬פrP:PEPIPESJN Ȍ۸8Ǿjjd$RE ,k|T60~5%Mf6,K8BI3{FL5wfR=uF2gT+27a)iG18` _,f@gT1GH;#+A1冞mySZryc=YԮnX^5IeWFrhmRv5 IlA45bq86ڮ<[ʪeQ+~^ӊ\D;ў:r=Cs#ۗd26,=LzۗY<`v#t \#ҹƲ }4mzQ=>]_^a0?J:JF )^2zzF0܎t)' vN?Jl$Q,ǷU}4ZD F2NNI{Lb_؞>2pjjslTZ?&9sc=g'VOʺNsU;EAn@ 8P+M4P#ȑ؞I6iN>i,YW)rFjA %YCD"Nק>ة%O2dhٔQYllR8rs#涵͋0Ρ7CLH{ rRp3qހnp?'@A۝9k?R՞ce/y5e@0uP:QL(Ҁ ({4'K[{t?JhER((?^zewa|`囎v}tEOe XP@)RXcUDUF;4w42HXeX`ٝ$x$b!Rq~ YWns0Aƀ,TS MKBI5&9M ̡_8csr \m@灎γTxE1$r?/kEn2}cjOk#`)j*$*OC/͈G?:ڹsw4f2Fպ#>V'2i0;F=*PY!Yٻ\׹'ؽ,}%b*?J 5d6r~chcߚ Bj@p TOd5G 6@\l)dRi3ָ۾#ay<KRtʢEKCު1; $WvbIbAxp) NzBq]ܕ3qVfݻX @U%T5yv b:RP -fFh- @ EPUP$FKUj]?tq4S[h>w̉4@Xq׎gZAx4Mʕz_ן~V:# hP}A2N8g#ޓLg2?JjƑ*3Hz f#0DpLhp02KQOJdq+5TQ |B4pI[Kƹc2x0\77c] C1♎ȡ |$P9‘Ӗ( ? m5RVqrc>!HB,Gֺ ĪDC3}gh3ˆ}-%-ygPQE ))hJl"+ aEq"$ӭ#Dǘ\{ xWk޳f2/!lW%^n^GzvQq*3 $k{fpGB=C\- ́._}K04[z-Aނ=r1֗ ?Q.s 9OnSE xJx N9i@'zP! `fg$S9=p> 8?U2;hϑvrh?C=^ec&91LFdz,Zk <$n֘qL(H߂"M֒ sjvlOhӞjGrN)4gk/*K;{8=)#>gږƞ5Ek1 C9ȡ# ?YM%Nrm$?)z>CSq@9 5RRr8t>ߥ\碜mAz^ OZnqoU'8I=)XJ0NqbJo @<. ?ڗnHqMN?*-q1 H8g<3F/9ǯ<\Ґ?ւ<1֤G?t7NQЯNii vUt uQ\]]CsvS"`$+V.A0`ê:umlLBchd:ؠAo<}Ri̷6d, m(G' 3"-hzUi,w,Jia60GQ:Q=+XbB GqCR:sL2hm[Fϒyy. '߽VĒˈܑ;pօƩmmp-d`@汄"cFnH?oLzV[oB,[1(Rw}=zqh#|~ބu.Kj\Im5SB=0NWU}3"{9 mÎPlh'B.ز>p_ r&b+pw6I(E۸AQ{mR)գ`BG❊P}L,oHfEuBKLwrSwR<ܓZ@ ZEs- Z(Q@+?i |JجqS@z(Q@Q@ wSYVʪEOe X$"j}dQIZ@UI핹I>#V)dc`(z)-5`l8g,=91Sv 4mkOmsJq/8OmP#,#wJ%"-p]׿ F?.s=!\.2=tCóm=;1@bz=izst6FXwr>ԀEFvrG87LX%I + *2y#=8bi6ූeLp=ɮS-OIFO5#K""N s1A^\Gz"АNG?Zg[4+"H r`f+ܺ?$gh%1RǿqR~$΅fn?Nʗ#Gc}B@ ^ʚW1f?bA ]u$C4]dYw7Mu{:ɳ_P+!)ZMQbʌ R28:Bf)*ȭ}?ڶ@Q!kq3_GR~`Ư~*ns2SWn{~MQI-o6'IwurXk*?wcJ7.y/>hPROj5.~_w(# /"G?Rg>O|q;9Lclq`wV'c43>M[wkk0&aCbR E\qBzcZ@A)⸅529VE񠜞yk$Aw6md~5~ |w޽#>ƀ" s(&? /tZ@xj/ ץk0`$55\R< #+.M>{3i;U3f7Oڬj0]& }du?[=TmhܔX6*j;H9KA0Ȓ6w?^ԐG9qkgx?Ty*‹F];j5ӯ$T3Z8FOvF3J,c~9Re/ܠ QR]6 R;bмjdfJѳӤm1-zt_vdIqڟRHp|&.4-dp?*{F :lbpA7 Ӕ7?ʰ'r=*@(Ϛ\5jgnK>26)P+;vp8@8V~F{W}ٹSi]$y<n8onYxCcb; v _a19>Ӭa q>9]e{:@(mIA,2I&6OH7$"/-# 9S9z : 6.#Qt[!)b۷ 1 wx<66Eד’ (QEQE (P {4qb?iҿM6(@QE (!sTISm!ڠzzKj1iR yDA6+'#xF<@UA R " x~]nϰ Z[)է$LM}{1tR>ӟ-8fC׃VOFĀ{ԀoHBzY?hR ^-YUN~5w9` Cw]{g==us,mHtq$t8cQ&)Ibו.,& qXiguضmD}s&dimb@⦩55f8c Cd HIbv̈(?72sqWm̍4c ƸJ~:#7%4vWs6GvKK&Ԡ O$vET 2Tz:~X$mc'pxco E]у8tHP[h=L~Vܢ5 F: qo i$mH5^H93,C^@. ImY#=y.3`k6}5k93̈>%Y6`dz?'#HA*қ?g>qh9*=p9?ғ8$1 Nb T8G|JZғxIzP=q:U )g6^هqzZZLZσT)*j1s·N'bE&٬헺VJWZ==hVFO_XAzIyXSZ^[[meWCA{?3j`h8OVfS #t5hܞJyyol?zak5}FϨ<Z +yqgǜm88ٷ)-bxˡʭbA w/ȼ:q(uk75VߒHW#xա];|n}zuد&PTG (Hm1ikJaāP=҃}搳‘O%I>ί9#j\/ c^֦GBƦ[^׵sammRH+{8,;*TM9k=n-,V[t0`NzU?HpW豨۩ךO@wLLJuzG -4:Yn,Ye8ZlQ,)8a{VpEc<5YTsĞqE2=Zx%q2Dǖ8Yz"xb @ ʓױuGO`F,$vC[$Ȟ(TER@N51 ۰d[anT$Ӎ[‰ $@_ֲzݒFсӁ\d"\@[io,fXgf`Me G\yaШI[EDUP@;Ҳ )1K4EisGz(Q@ -BsY5iq⭎Տw#^^T f (((7_-/jzTQ@u% dBT]CE&7 ?W2ͻBH( VY!C8Ͽ) (=N{Q@۫m `tU(dRDWCXd( Yo*0g?7n}袳+f"/'BOMϹZF,䃀z#^{-rꋀf94Q?\(4g?X~YXzI#"=EkWHRcyZ%Ǩ3_?%6Ԋj7PJfHՏԌ Աn܍g=GE뭎7oEQERQE(4Q@ G4)<-a")tȘn.:1jݍ`/cEsbiǗڛѓ|(:OH[nQEZar,{(IbkdΨU#ER*g4Č!KG4$q S?E}G0GbGNlh:C4M.jSX0gẙ8$|׎EGIKZyҞegT]+O啘FZ({TmGCjn%E*1Q IMm705wWkG9ʰ9+.EE I'?ζaX#y$d(vcUNќ@#VzUmAeCؾnu$ _ROocK 3Ҋ+YXF/^[X"Ll0QEQ> /Length 13358 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEu" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(3|G"֫^Ǵ_T|G"֫^?IEP0LгYX`# Z*r*4許O@ʒB*N܃{~jWYGT3o".gU=#׏^$I| W#Sk2|He2‰…S}}qZ1-#OW;,qs,riP1u#[P-ͬ1!eB#;.fU@1F {z}XWbkNJ.Ox fXЃ4Iepaës~tכ%*rS5$21ǰy'>J'QڗzQ(siv'18p% tɁo<4w]\^uD1Hc*A ϯ_Zu/ yiQoZ3kcGHuFQ~@[xX]o_ibp@3+r f8<kգ>hrN6d2Aw[|*jfQE P (KI@ EPu?m[RXqA=GYX3BeB݂LIgC>A5EuvE\t攒cN@`E?znǵlG䷺Eg^Ȭk9|AVql;NUцI4x)(+SbMD}9Uo@wd]Pe:qT{-#, ''3)sY뱝DbozBHYvȧ >⾱5x Z fdVe?8{jdg *;y}3.7S l5[LKZȑB"cO[#=U4ȼ60@rJH=B4n֑p29P n{R8F9Ǧ?h09!hnbIPwJ89!?~ε`:sҀ7\Ē"ȍe9i0T.t׎Cs8|izwy+Av:'R=A~4wLGלt@)r GNij!Tzsu;q3P0J_ҝ#piqOK@>o?(9OaH[>֨s0afAz0<9?Z̃SŶr }ZxOzdGsxH۪~GoQl?OǟOJ`j qPXAy0v*{z}m ̷:ÂM<:ζЧWyc4zx2G>uo*K F"xoGZΟIh7:\o99e#:?ZӫʬtzVѳn($W{aq9?ߺB1G*_?Q P+ qUhzzw3%-,cfF6{&LJD:Es!Ew${1ʑzZE9'hmv去G|s'ߊnGstZ%1č q5xCI N +KIyw> ?'-pPJKm?2: Rfgli3@}m%7-+kBqND*H9>V&x>0BwcPOsN*V`zө;eBGJfip Az0Oy )V4V,R&@Q@ýw (EPEPފ;@=z\QV{|[ag?EP0(QE 'ZzKCğ-j/kB/I]GQE (=(!P!h.=ƒQH-s@H l7 {5UH>\O-$YBGp"}N j\Mq8dJlLefYAXܐ[ǶzjtME:c]'=M)(zQ9$*n+Hh.yF}C $0ȯ,|V5ns}3ZY2 WŒ>qk*''c>I?$suf)US%ջZUY#VZ( AҖt((KIހ+]]6?ۿ*[{oFlH.,ɴ> i BT_u:v<4<@1nͻk:h&G.qb;#>Wu/#xĊU8?PkOJiQᕷI0OVS1Vn9*;'矸z\³7[U#x2/˄|r\=ͤryW4oz?EȪlcsA%j_fcَV\_2g:}GoOY #c8]8M/\A$bUU##ۏJ&d#Wvo ' 0DKORIqW"bmNm΀R)[($1sqs>j9XH20ʰ9W%E4w&h$QFFPБ~$au+4k"#5gSw6r@XAh#~*j }3KG4Z6j y}d\iһe0 :@ʛZ~=iNOnug'Ґ7=4843z1?* $>Ң1恆9M}W 2d>5n VF?Һ(ljp1MFfGmTa?VH"d209޻;8.Ьц5>h1ڷoOӏQN”;J6sꥆd(G 8t{d9" y?(g1J r{KQzcǁϥIzH= €p)aJ37`LAzqC1NG:J?6`cx\z0?7RrvO_Z*àEqmo{ z=ǡ.KO>2QVMR͸qw1~9̱cf$8O`5\-H,7F`A 89Nۙkc-z𚚺8bQEXqKړ4\QEb ZA@ v˲4-+l=ITSCrM 6څ"=-yQ@t7_h#bAۃB3HFpzyW;Q$7$SБJA(R#V-eiaN Ҧ##Hj#qѸ' p;tKdM$1exqԗ6be A?5+S r=pq^)D-$6fJ?i'8^D$;SsIřouNt+K$6jQ!7BG91zWJ\Lm#\͒-u=DcW)mk5yV<^@砮W4,VCrsM Y-Jda8SxrR0n-ɔ3(msXҔy]'bK0sבڑs쯩AШY#)+{TkB<Bq vWZ}6T3MY#1sק))Gs报gZ^1J np*i/bqm9p1\wtOEcO{y~'jbR5-Oǵ_\4.4ktk BC #ּ3g4 2]"TA;]]DI&p_j :)HQ=ϵ?:}h?ZV \"OC>uR?S?J@5T9Ϻ$k5蜰/ִ* W-4 A (zdhi7m}[*z0&"*ƙAUG&*רl*$QOM[D5]N'ڊ${xC3{H o&RH!/#. =Q{P=5H-"U% +%NNJvAsTXd09S3öMxz ͌5RPV49Zׄ2:٬i?r dtЙERQEQEdESdMiAE( Vo?XOյW_uiOb ]1]IL^C,d`}h.m2gyQ>;|AzՌR逴RQ@KHO(QPNjn㝶FJzXh7kj8-#܌~8ҏ€ iF_*Vy`pqG#ہ].k3YU)nr%?kǚ ғʬiPH2`Qz'끏֠^YEnBFU%mGQIڢE =G#:γ* H9q֎1XPS^qG4+i1F?o&n!^{ۙ$yb+}݁Z6G S-QP5ҭ۰!w}=u})O0yG3;F:maO67~j̫om+ycl4E@(1Q5O!v XJ6( QS1 [0 wchV1E"cǷ85ZF, ~U» ÷+QKc:^Uo3„vdd^&Fk~9hH2VwI6 1<~хfUӣWiVR. GH}Q\ޣf{0g~q?]m%i &PRF0-ONXpd`^*)y]^qKTR h14QUbn.pUu9# =<1V6{極p\h63t=}(4TAKx$]Ե䝢REQE%(h((PEPIޖV]Q601p~:05E>UΝp-5x9ޘ=j#vvp_[I,N0 yh,y~e{h1-9ѕ95fKyp{>uR:RfFIR #O~M.I)b?tg~ -K?¸@k B*#}YVL;C|ߙڃ`7&ë g8%QGfE 4 4w4QGG4 ;EQEA1Hiq@bP18ZQEv(_GH?'JڬVZͪ(Q@ E%exEOV0++,_ʵWE&hbwZ)()=(RQ@ IFh=(GJ(PUoMUe$dg$U)5uf4MӜI$Q/rb~?Zֆ!aI(G;UFI=Q&TSʬ@@Y07)5 -wӬ-bYd!:oVivce:WͼF6 VlcONVhŵE4ogܓ1 =ZkIEvN`H{T 2`';-F\\Z%bzsK4`9g 5(HxFeȍʜǔXC?*B ߌ;.9̿oY!`}{ekU(ٜ`ۺ:&!s ;0i`Y5V3H*̐nҥy]kD; rf8ϷQT *s' >{ב o+]vyw°[2z{ژU{}$67jEfZ)-%!$v'K1@$ 9Vbc@Ș`rPMyr1?Y4S-0u&* fvfHNM7W[Y j֒@~bGl/8:dc=&G|gN[kDq+(21s453-,\=E!p=OfWq |?ǡPFkM#90c~Ys# DLAQ@ 8뎼g'E'(Үg{ S"")$JU{^;ۛ`)<nqT)Pۜpx YJ`6Y'珧T+)=E*o蘛Z1Ƞ3wn:VKc3<4,0#U 98+$eXQ߆ [;p%9]B.*p u,z.FԹZv$3Vd5iyY*KAMeMId币N$gkts޺^c˯$WEcHK'3Ki1u7M5Y+)^Gjrʖ֑Po뻎rvBwpʹVsHC/ )s@Ҍ:Lњn-џ0Jgw;s=h΋"28X`Ukm6Vʳ jjr L_ l6,C~ и\+.$p#~?y4v_3;xe4 GZ1FdRr?ڼ@TkXxɶ*YJ\dƵ4qlUe=? 5鳲3ovIj8wvAӠ s8h[QRQ- E-4QI\KI(4RfKHOfLњZAFi(RQ@ IEQI@ IKIZ*9& C3bʯwDMI8dzwۭYVLȸ>wR0_{y}=*cҀj2.;dG9yߨK`}^t\FSf@}uҜ2[K/74U'??I"z7O ?//4WwQCR>ݨYnnu)h߯cFGKs]Ԭ/r_sƱã"2HњM]Xiv^ z5N?%#R y.E:].hd&9}o3?.њ9S%/(wye^⫨Fh09:WU}}|/]FisG)2] Ck.hH0ߏ9n!YaaW3MaНV3#cX~|n?J}969+{4f L}sg']x:݄}[nr+C4f35o33Ei+߲7ZgAc~>5ޞƲ46y=񝵫\l> h#~JI.xZ)r /3H )u6ٚUt\rG^iJ>Z94 ?-$hQG[=5PHt Bi?%? PE_E> Yd'$z`pG'ҴEfi(K|7V =,}XJ_H_hPw$Z^?#_( I4p~mJp?;=_ƴ8QG?_#e 5l Co g(N_kIYnV~C}EcBvƔkYƧ-պB~4 HQǥ_gϤQdzA~QlKoJ5+#?ƛbz[ߥ O?|m(=.a?Sl/TZyak~W)FڟbE.=&iz*L :G?‹Ώ?mY S( /??“V?@]? Iӊ<'?LUF4l:\QΏ>~@QG)=H5Α>H>IƑ>ƀ63I>O8O ٨K=ܣf њ_M.MR1{ Ka1fVPS/eS'`6Fh_F5=TQ5MSK7:jRa/M_-caXԿ4 pA֥v4[V}: )X ZZf?7p~ӿ EԢOoGM68lX cҊZ(GcQQ`5(jݵHXg@YBZ?[& }hBۛբs9Hb{^i\J֣dz?As\Z,%dwq_)wk ,%eHtm_km8ğEXkώdӗFׁN?KNm~MF;x xb9Q@)(L@VE0 y@&(yq`RwvEn4PƊ)n4P4n73E 2iw(&E(43Fh њ(B4Q@ 3EfE \E3Fh њ(4f(.h њ(@4Q@i3EQ(3Fh њ(.h ( E&ih f(sHMP3EfE)f(4QL(0(S3KE3Fh f(sIEf(((Q@.h((( endstream endobj 61 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R >> >> /Contents 62 0 R /Parent 537 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 62 0 obj << /Filter /FlateDecode /Length 2688 >> stream x[nW(Q@s{] ['5,ukEX㩁}|Ʒ?8뿷ž0Lo_8﷟_?Zj?o-9lOwwޝ߭_xs7w7Lw[w ~t>~>]S&|ڑ>S?ILf>n(l!&d3VNʰ}sL7y89mwsn?xqezD @, 5Nh1c0I]y2Nw 5*u{*\WeYqp6EֳĤ}7&a`v?(6YD$+caym|.bVYӞ !YӠ.Z?5PƼi@-Pc%2d8UcINo3ܺ%Hafh5:c,ƖbtX|i Ȍ(-j$b|b@=Q Hp.pki ȕ)!q<'˪Z~˝hfƜgf2pQsӮ AӮ{UecI$>62~FP6,3R33^]<38t> w3pߚ(B[Kr )ybQYa䒅P?ʼw\f^D=D@gV!n6R!SM'PK,%NcT̈kB[%шQȒr:QRG"kr]iuOHKWC>:uH kTePL OU`XHC֊|(? nZY琶$ALp3sd>S6&ztPl"n` *E?Lt4KP0W"K撬TX@Nꉄnp!!zRg.Tџ\t.B^idr Jٮp1xpQ:ށ guaN7M>UWprO#ȌOW` y򗚋j#I~ǽqlއba:>H pܲg֕G7R-t]r-]J^0)j|%nj$gqXM2U`+GG~dRh5J_J֙j(I9Cwl:7"Զ-VTe<ZF?x>*~jXlr;!fs.tq!˝q=+pMko,~Qca=ۡxӓrE3Rbu筜HM_||{/W֩[*FE{}ׂPy ,C+`1sfW]q)KXwN#"La:Z:~uyRWjȠ.A{aWqh܋DԽCtĩ^7N>!)W."d´J=E]-(6WhRd^ҝ=9o̕ŏB03)tЎP~;`~ O*񼫪b>HQLISξSNaV6^rK24N' \Ie@OZ.5lIOq+_ndzx1Ơy&\8mJ"n$ݼ( ~C<3*!U@uCл tԽ"Y/HsgRٲV-B 6Ԃ WSo=M-AQ(xh#%w)@g3Si 6B?a@gC[Iցf+AOKΖ=3޵j{> hx=&ӫX߉ghz)+3qP{&PwVE4.fx#Itm^k^Œ֊g U\_!Sv endstream endobj 63 0 obj << /Type /Page /MediaBox [ 0 0 595 842 ] /Resources << /Font << /F6 487 0 R /F1 552 0 R >> >> /Contents 64 0 R /Parent 537 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 64 0 obj << /Filter /FlateDecode /Length 2145 >> stream x[n6 WӒ 4YtW ]"I`rǖDQ!=>o헏wiuƘv{>&Xrp~".i4p'"Ͷnrzǧ^m{Sgop۸N|lSCv!FlbS*3efm((azyq^׸}Iq̱/i1B󍻢O$Z%^ s +mMH/BqY"=獧JheA(w.S]Ab--hQr '&8ZT&[ _#'u ]6=o3 L3k󫳋O13mDDc~dHq28[46Jmk_|E]~V$. EgRűieWW ? BEIB_.~X`` DZWj"p'1jWBx}cO9"Q'W!R&.} !Lq˦` YH,T폪F[-SWs_G&b B_+4A^8Q5uc09!R)@@R"V֋)cTٴ˰4(aBUiX*mTD&r!x!$Y)@]v"AWnDB.[XKD^4U窴PPiٹn1g ;Zs.Ø甉 ``M4ݘi)%l̤;K8/+SL3^[_N"1>VouIk zӣ,U{$Dwc2ze/FQe[iJ.mS#b5lk!#O'I?EWިw2ϜG<$2F/ g[K8h Y]"GMK$eu&E n*l#@3ӜNÄ)p;F*ݸ0(,ֲ x~AtHis:)sBuGXB0qC6g|m@¬[Iv 5X#.>M)~K:T`͓4J0HUaND)Χ:zwn~%ZL'i8|MPg]AZMO3^%Pc*VOrqW6N.w5Lz68èo/$fѠW(2ptƆKGpۼC7t[i)I}{$0G;[zEGXb(;0DY7 u슏duul5mtxq bpMN8v>I*g>NқmMnNr B6> /XObject << /X14 67 0 R /X15 68 0 R /X16 69 0 R /X17 70 0 R /X18 71 0 R >> >> /Contents 66 0 R /Parent 537 0 R /Rotate 0 /CropBox [ 0 0 595 842 ] >> endobj 66 0 obj << /Filter /FlateDecode /Length 196 >> stream xҽA >O'If23Jd}]@UB # L +0vUBab(gau !d鉊Qv؉#:5Xn]V9l_̒)}I˧ʙ{XrQ%$LIsvTʵV'[86 cu6S!ܯo_fHVnY endstream endobj 67 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 881 /Height 225 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 16898 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEq" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(:E&o_΀o͌uuTfxYSjx@P_ؤ7փ# u 1)?,U,[I_º-T/ƐZ`varGsJ4O,ar|C'EZh TVg$/'$&qgh VQ>?+iE4C$YѯEdWNDf ^P ?*яK?EoW6(Jt~׀Jt,~E͊+'8-hJ,k/E4V)V3&h_nXdg1 +xO=۔MYv,fhf>&-5X ,S?'Qf|K~OHuOz@lX'5Oj?! qƕwoO?آ.~z^&~ +z~|Gn\E(^j?Rk Z++VW.1<B(b?usV ?Կ /hN~@_j_ o(Jv@_n@ Ӣ>٪)?(4k4Eg}TtRU}tsB_njgm VύPjeoR+_Y76R?s^5E!}c?Z6BusNι<~/GO=t=;:+3~?4ҚilsV1ݧӇ]ij+#4۬r#_8ۣ,m{rkbvCܛQ`5seZ}]Ϳc,5??[2l2}GVX +#;XD0ZkYٚd- OW~lQX: ?GF_!}^#ᄏ~ @V?%j_ ~ާ}GSbhE/ 53mW z+'u#mQ_֠ j+';:5'#g?@W?sg]i{|ŮUewV7)QEQEQEV. ShFט(IdC7z7~%4ZW,/@?W(b o?]KN}_ӿU( ?t.Knc>V”iC¬@X 1.߱K+_$(c 'bQ]͂D:JLE8z}em-[DdYϼ_s_iDϡN{Sur~~;6*e,p @杄t6F)j 5\ FqQ!Q@Q@Q@Q@Q@Q@Q@Escr@$=?ҫrZXŽ1#i6D/$.ogZ @ 89"s;t + $Ԡy4=tǗf&Y+قs9T`ڐŢ(((((((3Xw~'jӬci5@Q@Q@Q@ekҒk+X _h%4QH5ܒH[NSj['vYCrHgk^Ś(b 'IUFQ*%qEeGK1j/iWR$t?WoM}!U݄b ; ėv@hL[tqo6!;9m=x?CHe۸c |޲4u,-ӴN8Ȍ$FrIǥKq(`2[uib ϲ~i6~ϴDovgYpZ2Y"E*H8J(((((((jp̨ NVkyYCޯ@xfB]%Xf lK^BZA 4j#ur2~5^QEQEQEQEQEQEQE"20ʰP#xV#5{oWodFOl\^[̈$ d$EQEQEQEQEQEQEQEQEU-5^;@봒9֡ǀ\z+(I!7n8X3u`L"s>Q}{X-[dh$!TsR>i|;wf-vd7m;], KTZ9ؾe_O8?V$bDp9>iأlPf5d]C) 5rŋXۖ9&5Vΰ vq=)AٚTQEAQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE(((QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEf_/ 7ZUi_qU@Q@Q@Q@cObG/B}Otʭcր@|<ayAZhsEqlDBF~$jP0ֱ*s0rIۏ4XNWFqRt Y%9u!NGb@h"GӪIl慈_+_Δ(aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP ((((Omf!Y.Kyedh?6?@Ͷ5ڬ+nteu1o5> Z;P#)d#Y;]ASpE>dmgV* g.ЧCD2~Y-Ϡ&5EeE4M.bW6d)OjԠ,I+"1:UZuA$&,dw$3r iFڈqKs)@-ǀ?3KD!@> I#`Пf!EGu=O?7¤fR~->) i j-b~鏹xVdKFF2?*csp[z0?CS$kM,E&EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP {#!yY_`K@]j:ڢ[M*XQ6 !nH<8ZꭦLvD :#=@!գծ4g ]+\UmhT4 @{qUexr/rĩJL^o.DiReyR[' cvpi6ow>wJ=y09h5%.eGg*'y=䜱jQE y<;.W2Ih|bry qZR$9 %v:S&aVzO*izr ظ:fQERMfu;;r*NKy${.+vS^%Ŭ6#֦095I+Z5޾6l'E 䴈n.nӈk٥W̅P{w(G3k庑eH̱͛76bG|jöE-M,YWb{qnt[Uk.&y#~g^=5HaE֑Tf4( ( ( ( ( ( ( ( ( ( ( ((j}C c=?b(((+_uz}kzUŮ wDbҫ)HPeR=&qMI%QF>+Va݂iӳ~JGdiV1=&e]ۂYPvb~X4W%LhۻGy M7j{g5|592TEnQE(((((((((((b8hh-05үYr˻ysi mX7QFp}\\nmqswuEXMhbCc`x:]m6g"$})%}f~}N)ͬ8 qI&I1H=Tȩv۰2{}懧 Ēp毁)hEPEPEPEPEP0(((QEQEQE J( uGUUZv6xF6 8q㑜ke"3>q$M˗7M Ofpw?6 9>Tm9t&N%OIo/b2^t.vԒhNQiK @dbӊH(((((((((( z_PիCX8F_QEQEQEV,O?b |YY8L-H88QRlR3,noʤ~xsw֮Oc̩$ɹc8?Q5rz.;k_,;#սG5ECw4Jd,4nV"$Y-$TYqѽJMG*&6Cg;НQL׷Zsڢ,Yz1;sR{׵Ѵc@Ka)*dg@HMff Objuѳ[][+7 (''ҮF:#`ɓz%GId#gPI*Oӌ~hLɈ .ϓw$_zɒTS^HIa._j2GҮ,70Bc>XvnH٦ nUӭ=,mK8vIK=>i}nleKdʷ_Bd}S]BO:J#%rXL8" s&p7M1Me/2Buϩmsi^[YȢVS$@s?Pj%2 ۂ d1X+:g%T&ن pA dnŠ(((((0A@Q@Q@Q@Q@6GXgrTI)Ar fiq;ɱ{!ג3]rȮJEh7I&A'+{i xp)`o%i9º ҶagK"(Vp1fQHQE (,U8?h(Q@Q@Q@((aEPEPEsE L P9 ( ( ( ( ϻk[]=?)UX2#:N>( }ZuvgbrXO$ϗUnmtx[@Tc'kfF/临9O 2Sy>9=r .%t&qF103Oz@utP9חkk CXb6a E2)`Jb@Q@Q@Q@Q@Phys4wy G ۜNxX3Z>o qObi&-෶q7:p3WFn!I%X~J;ryZBcߧ*E˄PԁɫF^滁cFņ*0?^JGbB(oP)4ru^ܲ3,F$Ó81q$2WAZU iVF200qxc6ܷRw'MўAv)0 >uZO~lrԞfkibԮ} [.`c**7VլsÑ~"wXԳ {VgHUs;<  }=ϵ4.CџeQBQ.(((((((dBpԮVb+(#Qf8((((((29袊((FPAUXlU&K?|ޭ@Q@Q@Q@Q@Q@Q@Q@Q@V)BbNTG4PPQ@Q@Q@Q@Q@Q@Q@ HdݲE*vc9i}Z{DimH5YZPM7FuQEQEaaLϮ9(v(((3EoЇCYLc2JT y\ 3()-huIC5mg5Ķ{% 3Vh kT( )M4U#>Hn[trc^=?ZԎ)\fUʯzΆ!w`7;?I XC%@GݻzTj*(.GB>KPlQEQEQEQEQEQEQEQEQEQEQEQEQHj3` u4BZ-fr'~4jpΠ&k+^)M#]G?2FHULIj)Ռv,7^\7D" xi{Yv;֞%m"0Hi|m޻gfR7b1J9~Sۜքi\\jS;O{)NS\E}k]$A k\̏?:GNzblpj]Q=J[.S\]3$v)*hڢ[y0XVc;n: buQ^Zڴeǃ@^b{txd\W%y p"ZH9 _I'~z ZnDu'48M٣)Q@dz^DKHʊ:8ETka)=gfi.߫w?JW~yBFyX)ٹhcb{C4Z\_ح8FP--a$HEjQYN:dx zRH#TzӽՉ袊b ( ( ( ( ( ( ( ( ( (1+ܗoږ{sw/yaYxXwBb9E_Ir0b:u$Hp8 GJRuU2htW*Gݧa>F:~5Z/[y/,+hp{FKw$M)qW9#A1Y>W3d.^֩q/.HYURMVmqר<JPC)m#r&U[~883~ѹ[|q1ޘ 2K7`;s>fHV,'i k Ȯ"R2ÏSL~Ԯ1A~4GҔ8@jQ? @'\sގ/^?zlG< :)ǩ׽0@$?POj7Lr3RG֠*9(C#c_5J]qFZ\)W_.e?zY3 ( ( ( ( ( ( ( ( ( k+ a?&i1 ?gtAsޚ=:(0(((((+_իCYhb(((+ hpx<U?Xq<ӎl[QLqQ[֊NtցZ3ޓa ֌=?!xZ!աI",REܬ0A)7v; nNdX(Na>7#9Wãw+;ا[" dp{T(i=2qwLDxs ~HC).[l=E3Ȍ}~.qA57#l,ecFN9 tV7(RkhLS#?Z>1/,1 WF)_>Zm]^Od8Vӭ,7}(w`1E:gש4QEQEQEyަ47N-uHB$.bTY4H;XRv"ƃ9ǘ{ޣgquH~^Oҭǯ\vgDg]Ơ%u8մ&(K|ZdusC UC zDr4sRӘ&$iDIduT)jwo L"ƹnHN]lrXȭ5km*vC*).ͧHn1SG1YS \# $s6p;s]ii'YrqdE:vJ̎`dp$? =S6 κnnb3@܎~z5h?"8s֓vE\rI#ޛڗϭbh.z}}ioýs=0ނy?zR~l}{ :GҎOZGA1h)֘ƎJCϥw4v{Pzu^0#% 9  Piԃʝܜi4f;gA*}R|8M|0?hVͫ0(QEQEQEQEQEQEQEWS"Ҵg@ ǵTCeͩږ0b@ܤug3GTP;YTvo/֚Bl-U[ῶWX  z%iI?cWKIQ@Q@Q@Q@Q@OuF-h /@Q@Q@Q@axEv[ARwظ(ǥ&{њ ⎂8-RgPh4Nx"zA(d,cpGB>N;q=wE(%sЏ_m!Ao@Oce֥Fn/B䓴cn.S>;j+k/TB1_ wvUTnރ9_[}V006~R?tkwъINj?:N(k,vwVϕoOKkP|7p$WLety[Rgo:O7w)pRav1\־rx4 ~qJ4RP0SyE! 8g'-&R"&̄Py?~F-.㻋zd`ᕺ5C=C)3۶Hv*3w֚beTQzOnKy?t%4Gx|7NK槨7 ( (((zY[MDGW?Q[ȐJ$I92G\umQY#nAiu*S=֟g۔XO7}wAW9gOw,&/. }ҭX+Y0\ wq{} ;  d1Dl|d`#55!Q@Q@uG7$L1-&YtۄfRf-Iy5A'gǵ?M^j@/~> :P9>RcXt'қSڨ?1HS|F9&C{TŖxhUϧ8&&k922W$?Oִjl%LH\HNk:kĵbFuH8$?+]Fo'Gk1L$9YZ)# 0 :p}Ej( (/.-ѕ'@0ϖ0X;)R.~{J'ԣ,BGAkPEPEPEP=[OM[Lt(YzqK&pYHV%sak@4=&-IOG8s~$W袀 ( ( (-q`K-Qd#ɒINOanё\r̭ka0VBerTFlkqCy48l#r#/&s md˷k935Hfv ?1kFuK֕QEQEQE/Ԣq [@ޢi%НQ@ )G֊(@SEOTu\QE1ZfTh/5 [fE #Yz;UYo ՜HQR!GOƎ4QLxNOQE_E(aEPފ(F>-rW-_В*ROm_޷SZ(燿?aERgЖ(@lO@IۢL)PKE((F{\F (gO+o^+ln8ʁQE6Rv?P;Rh }HBSRAE_Ί(TRӿޏA4j_ OEjɈO/wCj}7(TQEYQEV.'%SBaխ+oEQEQEQEQEQEQEQE7袚?k޲YE2M ȳj(Fo?/kZTQHaEPEPEP endstream endobj 68 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 881 /Height 225 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 36642 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEq" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?zԭYO{RFxȣ5!z=-I@:Z3L }){Q@ Μ=)ʀ3%O(n$G?Jc_x5qe*F=Sc[ @:yz~Rh3 *]T) Tbg쌪qo^qe* B+>;e{) 16 n$!?sq.3qƷ-YF3ܠUXr;Ohk[XLr?!h a2TuWU 1%㧣~ڣ,B>q3(ܯr[hYRa F HG]?k{C^i(HtImzpHMUc1OQl mT4<ݏeιTN~sVF* cLۛN z ZIs1:L[ks[5<ՌcEjxT_;r!`%=q47-ɬ^~qx=9idiG<=jv ǃIۦxF1Dy7}}6Q[^Op.AiYMmw21+k+(ʰ84k;.,/&10VxJh]2qy<,[$*H 5vj1QwAEPHU=ONMJC#E$R,J8Fx&Ph-9g`L U6'f ( (QEQFhQ3@f(=E.-fh6fx3Y&tH5GΚfuu03t}:Khʸ i loR%"]^#)= ,´hZ $$5t(375*z? kJ ( ( ( n<EW_X5Оł~ 1O(åV6^ipĖqJ8621\ Z`h'!K}ED.Je=oV'ti|& B#TMt<{?'JğgEؗB pFwb r~в1Q'!ݿn3MѨv<{"ұFd;^z5gu \@ţ~"TvĽ0 ,X?)#ZzьTWdr rЏZͽ@‘xGZSN%QCګC)$lc &9S|-.^HݿΠo"B ։""غw1_ӊHIa޾*~{d>|3I#Y2 t6yg$ V>]@nnzHL1* 5>86ۓ'}1YՅӪ׹=WB jӣ r@B8yo%sk(,XsXxǯjV ,o⹔H(;ĵsɣŒbI=iYVE*0<FsJ4uSm/v\G )oN9Y}b[e4qGǓ@ǧa-v6EV-bHn~֦d&G2X5cFg!UFI=]$##ǯHb/;l*s:":H٤ qchSZ2X#2 V֪=YO=:::Ӭ(dB\:f.b5;F`p?tT((((({vBTF`nk"@X6bN<®TP0)s#ץcZCcB@*l\7TѣD,̻#r{Ws=⢹`6AvSS^fW^}A\N 'O'\q4Np׌V#iR\꺄qw1PK OOZCO`9 mS+[X-ٲb#_Y9ebY+g=*bڃ"h@۞k:;I^o(Ǖ~5oސ=jPwN;Լ1q&coa%5e3b ITl3c&=~43o\AcɺIbG{w(q{Su*fXݴߟں@~Q֜z}{RNC[I2L=y4FAĎqu+ɤ̙] Fw]T\^ݩzv=ozL CA< BV46Dl_}joni n~In:HY s֦ӴzdsYE"vf=XVyǽtӥKr*M{:zGaU+*{hԖ6 H8y8P`i"<HFG^~9EV%Q@<_kwx25TW^C{+;;P31$OIO?mDžoj4ۚn{!^=N3`aX_L]CjG_o|;b 9ǀkjs[i?/?`_iG0k/G0XJץ|'?n]Wg)m~lgLs?c~*x4-*wETg\v'| >i>߱M˱;(˰=lHXwm?(C| gN>6—*ˍ_+?}M̱o~)H=P"cR w}A~/m?)CUby&1pjZ[)mt!MHaEPo 7iVo? ??1ZTQEQEQEV'Z'+na" q [Ύ):vG(qAޗ4-e3^Im8cjփU85uc&Ky6RPӞo|=\"dh L#5w:ҬMѨl0{S[q}J'Fe]:䓊ꄫ$Wc% nSc p=t=Cd"\ dYHXG ?ʸ:ƾ,nFHXuޚuޖTű.--Gdi<ִ4<ϖϔb'4T^\[48;\z+Ck #H;jA7 4x q㴑GhT2ޯ޶r깺k{[S+?@~Rz?/Z$&qpAҖVmB$ǬW EsuR 9@5o!ddlg 3U=_NWF2Jҋ吤9D"HN7AR\ ʠJXRum.e_4 IoLPi26L[ ?GǽQrxOC}AJjjhqF0k.WtvQ-A8 ?/jtw?'z’wmϵn{h"Mu=Z^&>r\4gsk/7*Χ9mSMO"TWZ&ި[7qqpNA-={wWVN=(rwt?֑..S( hUT.9ǮHZ++,f8vΗWqF;#Ijl+3F5 wܬ#ivgޒ T#ӯhT@)D;FpG?4֌g=hϧ幈ʒ}j1dg^q)ڏbԵ kIi tfmHkm&nnfF8[b(lU".nld_!hKp1MnT:KF@2Oe?ZդQHaEPEPEPEPv [+Dt@?A Ѡ]B(aEPEPX~1Z·+*j'#5ŀ8 ^;fH#gA#tRy?nrǭ-D0!pҠdw )1#2+.ӂpz?C@zR3GG=himYmm*F;?FbSʮ;:+o-N+sV⬙.{M+ar#R2+Ns&ż* d $1@B0~V'=zة:ؼȨTl4tiG#&mJ{?)Iސ~k~F  {֩ƫ"u*$踸ZFs2unNc ocH6ǣ*1qa+S>hRJ>[!$y|wi!<: XOj #JA& # bwT{_7km?[kpe1ʜ:5c>^,Mxt>X5mQdeOțE5sHeu~?Qkr.%_uSGNqI!{ٔ|IΈ$yU'IfAXƴzĚf;'DЌ?789k$;/ >h}M0ϗ}xhV`TwL28'֓H C6<µL\VH ӌzR E?{Rgڔ{PM!8B>=içހOʌpzwI].s=ht{RcEOà'v=@ xޓ(=ED`H?~+:DYhnW\QH7lTcg<&htYe<FA-V1)ýbg,G'9cgcB,aM$nѝ_GZ<^ކ=3UNmNdB3\uM U sJԒ>yrbN*?5mKfOA č2u!I&X[ݏүQ>޵mN3i{qߟfꦡèmh8elqVOƔ446f`62-<Jki$".{*k;Py&K2 6ÏsTozdqܫ}?;Px{yf5m~aGb:ق%{7קҸ##ё(8Wh?^zKzںw$ӥ~ozL;T {?Sޑ'=U/!i$TU{/c4 > y~qߜ GGTv__WyjbS;vRg?rr?)R8N#*-D=ʁ9>RzZÃN'Ja?Oʍ@:. aczZ9o B?鄇9OҟƉ$k:{Zy-͜Cߚ[MXAk ԅa@pp=Ƕkot4IrG>`}-.IW+I5˩1 ꤓdS ;w֘HpulKcD*IMX(y؏I8(J)uǡPEPEPEPEPEPE [-"I[A} l DfD*O:uO+>1csCq !_51g8jvu\+\Ԅ=}r`EoQEQEQE jzP;""=;b3!O>hO6I(Qzځ'>k:xTFxaC82v~3]XVa??k`q@KEԳG#\ U{inaY>Ѐ7e$J^ZӱEaљPXZh5z/(vӕAQ+,mLG?V-#7kt9!xA`qW!)4n/Ҹ~l`0{UK dIbz2};U+3`jރ-D+CȽvZFtQva3Pn<.O1j;gM6nTrݴ wQR\Wo/gҫDx#;z*zVGs2hXVPs:M6mJF@74awd5ȥa܎=qفpo^2pB@ N0NI#=O>;im]SUp|`L~?h"NH]d2> k q4)yqZPE+c:xn5oQRG?o?,zuI[x0۟S̺j\)O?Q҅(t~Lq׷FxRh{ ;zӉMnc!tqǽ.9ڎߗQH?;~] _QsIۯcN:FyOJ#s<yϧxHg}2wꭽ{jnfbj ifE }F:T_EUXe!qLW'w vr)~˻2Av糯- s4!z (Vn\Upjso+CkpG=j#^+WIil?Q7*e~bqߦyr+x{k>0w=q|Zq2Z%b!Vt-}ҴmeuH䶺CyVHOq3U ZI*LۚQȀG=1V}$_m0s%YsGsU%|o/Oȼ3YIɋV&}_ A'*76BF<E*(;2_iHzCA>"#ld搜GړUb!,Ľ\Iro/xQ!*Mԗ,n*mw"k}ρ115xuYi3NQ\8#ް$Α~caRx،DO/%A!K䌤f7vL1uKX#,c,O|ON~fҌ׵`í\K42PsȨɓbL$p:G>T|穬NXዩ\3oSHג XTpA *^att0O4ĒQr:Xm!B탎yǭG'_ԴԊd5&2NA nW>Ad1?QV`Ae(iQ\[LrFqH1E_:((((((wzM-eE*zr&c7@P,ܨ9}sWPoxo?+3/#Zb ( ( ( O{jG{ڭ0a5Qe>cE"Jt}*CsУl'g8\oZNcֆҊ0) {Uml}av[% eYc$sX!C}[0 e >˶0[\()o/ Kqz\"KgI*c?T>!fG+&"KܻpXgG/Qn\fd bRy?/\taYf1 F nqk 0Uwi`R?jw5Je6ׁ?upptq cq4Rҷq FegÎ㞸x=d;'e }3P̒6Oejë:27fd~ul}Y َK/=}d]ZI$I|\<3.ADZ󭨥YIcmH g$Cѕ_M훞blz~V. ^7Mhv9u6ˌeF{ci?**u%muIf\ y3ʿJ҂$\pr+j-mfD'#:3ZʋZr ;IX}:&a\ChQ .Q#7ktu ޽;SmI" fGȫEpduRzBp}?ڜO'#ڨQRqPyvր1=:H#=y#Hzsb3x(W. R)}~yJȾ֭!h%|'ڮjVHS Uc0GR#uz3Inۙ'OGjmԚXůF}=+ߵ4.q1Ʋ>g{Ա9YW|Ly)h &k`xy} ^5 9kR熱2<_'×#@"?&?tj7I-Ȳ*x'#ׯOQt\OZx~fYnnDJWF=sTeኡ#9E8h^馛{.*{F8x>BNj~U*iA{'| 53Jڕ۲::)E 2GCNFeλ-<܎ >~kue  Gjɏz| kB"ٕtP$b:lsN~Њ1j:oOrDH| rw=kGQ{6U'n~dD)'cH$L20G\zVP/YxPG_#A{b eXMjBdmΫ?x ZFq֨ /dIAg۱ɼ¢L}ʞZ BUL-ޣih5ܤ.'NWEFLc]C]~Ip?tl>h E۟ҡ[F"(|yr^[%$gm}):rNŪK[1P.%Wۚ׊Žҏ٧.M'.!nO Bk98a(qUrI/5z=G֩pN6ʸki&\wݱZ 'n{H s׸`h>EeIcD3dVT*%*]F{+ueba\ssR}ұ ޝ81Bя4g3_`ߧF?,24Qw[u]ko Oo &^2=k3g.v@d+CFekִo)QR[!=|Ean&KEF2' H8?N E:VSص++ci Run2}8?x7R35ۛ]A?ZxkKȉ,.] =ޮi\G[OU@>Ua9:>Z-3cj,J? Fs{tXcE%ղHr{}=uI|q@5}O1iځ>;}jͶA F*+`Z6GX^)ҚK p g?Lg𦮞N*Ws'\0sOְ^mJ_%F\r~nP7)㻏=c;\}AVo#_?:@ 4ۑ0FDx NKKmf~덹¥>fR+5ơeNlJV e8隙8z2FDv*1:8s@tޛ,,$R^@<>TOzchbc53dv/iD/܏GןǶ+ (N~Փ]W"t=cۓ޵y98X~dS;+c?Y3G{s???JZ >_zN>a=? 9q$gi>OAuigSװɭ!zɼ&_cZlY"[M BGt<ŒZ>ե4K$mXdZsM[]4/c?g_Υ$TQEA^n!!Eے rHrU;M{違Eۃ'Y 5JH b&;|)\ sБM1I,pؠ|ˢ!tK2{V|ܫ]ŋUEk\+c?>=mBG|6$&mVHH#$.v CPNɎtZ#m,S#`98>^ nٮ/uhXK.䐫 ~Eu2Y[8HU[p4McmfTQkrw<̌A.ۣ-bD'c9短U@k7Vb##<4_lT77yl(!e? jiNn#LNؗt"u?AN~6ЛFnR%#{=Nsz%}8JMM[kqko*KlqkC!k'{&Eyu<=kU-`nFU@=(ա^NcX}Yۓr=Z֚5;kV2*2НL֫"9U'ޅPc>ikꚚ܍_OB`2;5& H ,7뒫O:V~m&GE2!CELڄc̔yuҼTF!TU*pw\QZn/ q$o ÕL|팀}H-s67\[t%O^̅dFެ>QZE$' QB}hzw=;RY Y$'Qӡ}kn9HF Aܞʌӡ?djt^})  :61zPYc* Pt*iqnvdZԣt6Sג+ښOBkxI6pTl7_M-N&k"ķb᳏@{} ]8_@՝ey$D]cIwRpVOB4YDJR4sȭ g<ZvXfy)nM<gyb "6ޛ}dqEp4CJxX54'i G9!`}8?|gfw]Ej[(#1JS Xw.cʄ$\ $]Iu4+as&@{8f)]=sXfN:{* *8J 9ړ?ϭt+*}B#S֡?&=;U "GUuqG^H^VoL5J88=:{~8uA$.Epyxor&KpAջ+s .dBUЏzcRќQLd2zDd71' YO8"O\h'S.@Q@Q@Q@Q@Q@~&kRwU: 7Z{5>Z(Š((EφO@5Y!sTI@mJ=bp* F<@ƖIlR2?ȩsStK:ߎ Z.luvɤj1Mi>ړhS<)`P!$GrL\Ԥq\h[;hul$7W%FumăSAc-xeKR đyDeBFHyZZil@QR0};RcZ)N10z? ]/O?)Vl?*IdAULt;Q5WHа.c!W`۩flJJ_UG< K)Q2#1\E:`k:#*C0bH-W\c}@V8 q'Y>4X?-e绔@UPWgV}gQ nd{hX','Vv5KUO@Gl׮xW06k*I{& =.{8丅dF8JVer7+^."in4($y_!c3[FEi*䐣O_PA H0ڱy>ի?N W=%]ܽ'܉}?LUb3 <|cL~Fi7W߹җOmC 9yx8'WV7\4/M{&ȓsb2=OKvq,&çՋ{xyb719f>穨$xiF2IcԺ2xڄv@l$Rq^>B I$+l,%2+|d8ߦ+'cѱ{QV>_JL%E_G7ṯ/ jX<܉Lc֌cӷoz~ޥq{(~6yp `ա>8~YJNN$x3IJQv=EH'O=iN==qA#ǽvQ*^Euᗎƫ-ۘm}A~53:qVRVPa𩦖8/+A v@+ o;CjC* PrG|GveNּwh^i0[Ҷڄ協\[ FđȚ$I: "V=GҺ!cu'G*M' sOaGaiTZߦ}~8 *z`k ŝ)̯7PK*塉f{{QqOyl#-|6~8{o]\i씳b]Q?ꍯd L1UN; 8%n^ظKsGoiVQy&A'$'&6;MfDlܸjW pa3yx<T[|;.D ,S =dv6I̦w㪞߅B:1Q$2*9@nb8qϯ~Jn_,g=}΢f4!vڀ 'j1])^H_b f $A %#,H;HMmHG$,Y*ŲHIOoK߁RuQt8e''v 788Cw\sK(a'l׽RHQ,m9^*-_BW$oqէ({{T(Zeişɐ>.SGo Ixz_uZDsf2mc2TNT;)^2Ziқ7sD ܥʆ XoKHKln2ǀ::uΔ4I&c*_.@A&jt8v)v]:D}>l?R*}oFByC[O-?5?Oo°z;h%ݷiaG=ps)N8{Coqoݱa}H3$3K18=hW4e!UA O4q8'3K5wB1ѰG}רūQH(((((  kSi?ZK}+;|oSY?Z>ERQEQEV?]_օg/j/hݯz*H* (,k4O}OdFDgs#8?{5Yv`ApO?NjEup)MjsIhPvi>z2+# Fr(y@U: ZCNP1sKoLP!r(c=)4's@ 3G'䑔ƈWڠ WE}RF,%Hϖh !1GV#?{t(*[D%>\Fjk;UtF`O LӺ9L$Jȹy=+,NWj:M]~"Jnjp`?Ob Yn~*2*FF==TBzX_B8jg88n1 FNoRS̛6[)/k1GVγJ,ovD_C\Zӧ76opdѨ=3^iV);z<9c}V坟_TJda:NxpxcߵDmNaMDcs8q1 i@w=3rOiX]e,mLgO[  VzG5 DW0&',O{d-8˿tvBnޟιi{d-)d]JsI$}zt&9BHpT-Fnȡj7&;8޲<=~$v=<5WzȾʷݿq<ڌzg1q33UH⪢iԬkQ7z^5q]9{ґD;W[EuV_}s4K>_B=}>W"J3$,0en3 (bB$vZڕł1Ugq{SV$r{GɒG9'ewgI2gi€U$vyۅibiV5$01$IrG*CM<ؐOzQlww,}>|r.0w#M1 !Jc# cAos=.z݄P 89{R56`Z@==W!3FVUrINӌOO_ƳeЯid3ZLHBc}wkNHKD1/bHA ?(5.%*_)?V+'@o;rY\UCBv+ZsOeM_#>?Qzjsk ET-Q@Q@Q@PFt DӴ KZ^&,ZǜKPǔM@Q@#"` -I XAKQ[ /~g">wG,՘J@}hi ''֒@6 z`;-5]J[ȬȖ՝P|>>fC) nBgbT}گ:RF2y5]Ikp|FB+=*"9~i,RGfEӡ˱ڎNA&[P3@'} *߈RR6fܝr@AԹ[Gjo o! وא3{}r9n[ŷL0=Ɵ#&t4bCܢ4 nXO▶0f̾hgI0TGEMEÌ}U*4PAbi^)|qOB}5bIpc`֋RA- \z]J+3q4da=|TZҹNIϝk<m, kYqH8eQBf*>SOƻ2$_{隴oYݎhx` ~hMgW8spqSD}9'ׁVRnn!|3Snƍؒ!.~8\բ9MwǷY ?`\АV\ !ZOOP\YArU3(ns*.Ws*1s뚄[<|VUd f! D}01ҵˢ99woTw6~k3-hNEH@qӌ҃;N*.g'xe#ӧ=I:z3-5֤[cu\q= gS-Aǯj?Nԇ(8@Zr9Y;eC_Ƨc~iEܶ%g~xvU}[8 qސ CQky{Z1=>>E?'/qK{JoyCn~-sMjfNQJ1j83'oʀ;z{9 O@ : Gq30 zǗQچ8z. S"'J 썮ffBU &4}_u<:J''v۫IsjT.Wr2CR0{nԯ'O {<t] ܥ`1nsۿjn7[,pѡqx'45`<~MD@v?,Tz]q: B&~]?<<*3v*քO(GP=:Ҩk"hzE`Z| K{)%5 Lq{}Gjn]=PK!qw\gHqb9S0G5owB@܏_«\iI}P}H5&r֤]U$A"v<5T"P89?AzfSGt A<~5@>KJ#=grd=דr[Z(gYGzzHLBw^k nod \2L?VB:Zt!D;!2}kj\r[eıT㚶[}+!k+LV!v)d#r)Ղ`Nz~tu.:g?Ob46'Ѓnۢ'*=Ru8`ӭkBȽrOS`=ES$^^UVAÿ5Ɉ)Az3bϿtCng#PYqA=*kiՊ`vpFAbj:s:]G֔R^nG<qpu*ҫku;A]ܹ= ´u2XGWC.!jy!%]Ѷ >-ȚS&2,.aEyUh'냏ʱ<˫n{-rl'F oTajm'#mbJps֤mVKv[Nխ3a9@UUt{k]6\ۼ[03㚭f-VoⴼdwCLmr uAkHg.˕-6099ƅoo\AEtD|#p@l3_Uu/@5bÛ oRb(((M\Αz?&%ʦ,/((lV##z UTyeeeuᕺժwv& 7F@Ϲ}QzB3LA 9R 9!}? m*)'rp`;E!@\̥9-qs|smn~SF iiH|_TP1Ұuii,2!;Sl<މ7e-&;;?Ϛi<d#ACèGFGk>-n۴ muqUN>ޔ֠~< Cs3cT! zU-iRzOA$ҷp7wJ| fQ廚leYe, @9.ũOswml2냞}=zꔷ. !'xnPz֚oAqo* =VtI.MɖMYf OZRi%Ȃ*\Pxaʬc Q]Z&IY$>˺)I<FReEר&OZ2ƻ>?Ux!bLXꎤ{tq$kpg%jܚ-˧YU5ϥD3yqLj G+:!g;=Q291M*걬GCq+R3'rFj1|73R<>Ķp^y8eTpYAk XHW$X21[q%@1(R@HM^3Mqp=?J\ǵbTv)ijW+eOBA USf,"$yF;~{J Tc=涌;U_˿ nx?G׭Q8i-5 ;YI¸8|p)G(MҖÉPWSCO<ԸyZa_ߢ1\zƩ2,p}]28SfV,$72@)\\i+Zi$Mm yxГevSk9L\==T*_ܖ u.[]): bm?PmG~fq_#WR$6Wg 5i?!qH9B2~ڲ>R[V1HK60S"Vwid=)+T*zUN1F3~=l."Put ;RQ"8`0 CW8{ !xZj)ɻ$DڱǞWU4QǨ#QU%Pw}}?vjRH$NGTb;czMΌ}hcsڼC>evcUo8 ⫇})ȖGivC@A8[}2N~ս\嚬RHkH6{c8>%DZ+.ɒW[yncnD4e$7X^';Npn]=b>vV :JcϬfx!Ic`rQQDZ>9ܚ,QEQEG\uN&k\ Xo;~ _S.(Š(( /U/]FOur_*Vi\SAf (GT ֛ffcJN6ظr_,e 4ewg! Zjrξab|2,*ٲb#b kg"HrNsִ,* oQg1]ST)A;\;'ZGekCo!9ڹ{ W1=(*vG~FD]fZ]$ƀ\)9z,MZKkogn Q#IpTep>Cmhdy^4,n#֋o -dZ@&E$8$Q-X-mCK&-Ǿ*Xr^\OSp?*m x.LD~XV8޵YNI)4*2qwF]= DǑpv㦙jo[I{n lI9@ {Z8ZJkfՋo%אyJ^Kh$ 4R]ۭҴӴQ30 u8/wޤ7mIqQbq7[8S6?o~l|uNXVALҦq$C0]- RKmg}5 [cw!$w4YNtڧ=\wJmj2<`Mp dcv7}g4X^ خ`|}˂=HlaK3D+c$z=I-\4ݓ \d`)VԐs{}/tN1A,T,i 8 uGiZ˺3ta7tİX3 "eҠK ,`)j|,#srrp& * Qk*(?2Hb=t8ʰ➠J8?k6DŚ/71r7{Ss7;BpEMլw@ʺk^;T٭y?~ ۽Tgڪnd_F.?*D On_JjKb6CYwYs ގOfz[t* :R2iNK!H?1{uc9wROcpqzW:H]a?|Uraϲ]>tt$7N-K]GV>ȬnXRnºiԿ#&eeu q}k@帑VR1}ҳd0(Sv8oe8rmR) מ#[y9Y Ӭ. 7&O&^ݗb}+ EYÞ{..-ʻw>Nriz(+3IS4NvKNs mI"g("'PG#X1ſBHOT{koT)"ĉH?5Z[8 m=;#A`2v?r0rk7;*F2J6};>ujD OB98{if\N%q"cdUqזvGewkffnǢ𧵬Nb.M iZQE ( lREVS04d14"I}m-H QT\@#֤:XKgFFo#$96PStksE=S)jwb@]cfLFX|ZpJWx.-Q1_Kq>t V E!4A 9z'H.[ ~8iw6oԽG^hGNԑ\+#ARӽQAކ<\Zi?ց 2>xh)YmhNё{~IU?lE t?xA~b.Wj|05 ādh*Gg64,HIFvoMownCfEs9Pu? v6ThΟCiB/J2^*(T4 G9rp0i>9Us}ov孧,&#~=*ppy)s?ƥMX,espxcK@Zë4ڬTc c>ta֓1Tlz'{eY<6 黮=K} @`21?h}\wg2`A$H'bǷ):q3Fd2EfnlP=OtG,M1<ڎ;b'AP\tr[$]gdRL8?=J¨.ij{U0iXځ}{~wrKOu4/!o]yy&YD( ctmTW}R 3аEp|pk#f֖-SN53nS obcwnkrz =:79).Z׏By_ZQi*`LU'6a$ch`jd n(O6DA+> ޫxCWfj+u9Rw{h fUCg)\ 2G #/ӟRDm9OVuΔ,|F䛜B?u#?V5ֳv᛭GٽU/ t+WL6K\rNv'*mZ$=Ϙ1'cǵ[kU=otw19? zZ1voV>3T79jаnXx]\t%Ia\}_NNɌz%c?1Vyqڹk)NWjϺњRDiS0SQcLwqšM I]mC#;O;~u:iqm.)>u&KHx횫kF݋Һ"J%n)䶏fVX3AYcVMCi(jRǩ4@1Z?Sp ֨w"cH[=Nh̻H/O3}Pfb!cBQ>UԿu\_fs?Tn#Qhӿ?S2QH((}roh#e\An((((Tu\E%CuBBvVG fzŠ(c}jQE! :~4CEԣE0(hz~4~(ҏ~Q@  *uZ(~_(W(=*+կҟEur^Bzth7G)e!cuQEcL%~7E8F?_H{}EPG)_FtC?V=Q^oqݥ7QE h(BC5O(ׄ!-ܓeҿپ+.v?ZH/j|ƾ_(oh8v_+F?YjGڙ?QS+:ŇєBqKe\dQ^7F>\IֵES~ S?j(\G#e-^93m颊Ⱦ_3W}?EmSq_~t?Wf V4w"+J{WJ >}?VAǫ})EЎ?_]v oQEvW>1-?S?^4Q\YG6=w+hiP (⿗Q]8(v(io޻dQ^}O.ZUE^<$p:J(aSp+C2 tAQO袊@QEQE endstream endobj 69 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Width 881 /Height 225 /ColorSpace /DeviceRGB /Filter /DCTDecode /DecodeParms << /Quality 65 >> /Length 34261 >> stream C   ")$+*($''-2@7-0=0''8L9=CEHIH+6OUNFT@GHEC !!E.'.EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEq" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?ʂf6U=Ev3g8m'@_?Vꞑ΍c^"PEPEPEPT|2tUd1>۟9ɢIhV"Ob8i0;v,Nɖv2*+塓ڻ)ZnȂ851CK?>qY$ِXL@< ?W2칤oVZ2<>^Gz=G֘ʼni4r=SQlSJIJM1҆y3сƙߜiw*!f8}>13F:w5$h % d)I$mJ=6 MAC6ASZA* ()Km"G&ee:^=62mx yIsէN4Ց5.9zΖ[wH"b[dUpbr+k{WR"k  [JK9\qӎ;+=.~1Dc~i=N?&yǢ{(jSqV2VVsi +kF8d# ާ`\DdB3G2ૡ=?Ӷ[Tp'BNRE6*Yf y [3BK=|8Ɉexf>+u,%(/!v|8G9>ss5ͼqU?p 3aT}2FzjM0\׎Wb~X n[1#qnNk5-Zx GdPzr?@+мMy _N3 Uc}-TLK:;Ǐ{o] vwnC+>D'idSj5hGJ1?ʎ3WAc!dѓ N$j$2V +7V~[T3giy=}5ӳ/ݭEu;] O<[HH9Y ۺDy\\p}GQ5]G"w Z8uRٞ*) ;o< c[dpx8kZ;%6 c'P:qpj ^1"Ÿ 3\8XN}_Tj#S_ _/*(%YT'lq؊k0hZ\!WhzWY3֪zu 8VIO@yȒ[ps|wTw$ aIUISo:1VoOo{!Z[*ũgAii==@qϧBuqɦyØR2`޶ˡsd9xu3zңI XYۇVvq:z*Kulۻ8#?:0+MAi*{&F{LXOQE ( ( d d ??UʥE]((((4I9f=}+Sǫߙ&F3Uϵ8)1ޘSsƏց ڃf:1^ 8z!;:1Jj8'oA=9'A4(T It ^fT ssNM"zt$x۽$e7O8+bAq8>V7 ")Z-3<'~t\j[j1H i TQf t>\g ;ԓ6=Hd] uJV}]}?ޛ4I$mVB!ᐕo89k$}Q/<z8?Oz͉֓4/ج8\qQ< >ZIR,nڪ:& ?Ajťld#2cje.Sz4]GF4qL(3{=Cn^{pHsRK{ ˳2|gjHnMV"Y+ggZ0P\_hQdChϧL,5 &PN팎(=x|H{>e Hbx0:O^53ZZQ\ob?Zт+xDrI}MH:z⩋xI-L8ؒve s?2Dz8h+ ʋG)sX8XFK*XNC/ЎEKiGNF]snDGE8RYxԎ\Ku3רCTvkvnrÌ=zp0GҋWKWӦ?QPĺrZH-SIg` uI ־^XM̌-K*2]O nyf!mcϡӱxvMԯ,i#c8l)%P:͞+-hف9nN5^)t4nIOI:ʰAҪ ϱ,GT}GBj01ܑo(꒐3=k|Gom^e~TvN2>S(zctR)V8t؇Mlg?ҹoNjzm!?!(?CVSzbZKa.mǶ?7"ܗk+N1" 0}>0=})zz8+4Y4ۺrs:թ[wF;E##=Rc~"OdS|;J6Jl?%8)3_jyEKp̓?qzv~;&YrN> s+eZn8Xt9_lP>}iJ'?;*@}*W ҍ?Z7w=h0A 7*M?*93$g?D'bgfaYFHG9𩒺5.YƲ## 'W9F|hn,يRVc輟kGYcW#rAVU.Cx#ɟ?ʸjiv=3RUt;{Mm,ɱ9c$d`+d-a֥@$ΐ6C5zIG5>=J[r ћLU_Ȼ׬_C6ToT<?/Ut$Ң) (()7ҖP=@*QyAz ( ( ( PFmtH2F}A<ÏQIj?hjZ;zP~D;џΊ0>t@<{Q@qGB 1KCIڗPz75+9ʶ7"): J"jv֓ <±X2qڑ[EFd?$O FAWZ*QjIYjb #n{ 2$䓟Jl^5Hsȧ?Z=~1yx,M}Ƴijea3Tܮ\KkshZGJ+.k KTmZI G.: Z* ;3}ݰG\dodP&b}$䄥8-QϮs Ƙm%=94$ajl'gq>"x yJ>gn ^d|Uyv/TX:5?W@u$kH6|ᗨZWkv%9aREqKh8 3K}t^7L{%ynA1Qvh 0 dJ-KbsOT=?.GZT2 !db0ITG"ʊOqpG@8i=r?Ozpvߍ&8890={{U-Z6M3"" w?W8j6gQڄՎt0e 1ޡbG$<>ސIwOKtEc#w?Yhc? #c$XW[ॆsVK[6א58w.@\ O˜G#?>t(~T~?J7;`aFIV-QVD2=m. 0?Q>n% Gr7daxO<JtHlkzÓɫ6!%a%n}vfUAy9ͯ~{By?Vӷm KSqʼswg+mNzSICJR:P]B |MnBzgT좝x8F1εs158td& @^φ_wh'pg΀ОP{W%&ːp5ځ\]ӳ1%w*9Y~CG^W( xC5shnpT~B@=*\_o*ֿDSHq?|\݂qzRLo+$nLn7.~Asxxa;qqUe?9U#Uڗ*`O[9iJ;<)w 5geW'/qz_n}4c'#=E() .;pFh:\ R$}Ad;)&6v>lj֯m (4l9_qz LxU0;YNUҢpRVfʛM gnudUf|>\3{ H!B y''Nk{A/I'bGb?#WY4k$d4lR:\ 8Itnn5 z}i޿ZL|¨a`eIFg.,{בOwsE>nȠ40WMeuk{:[`{H5m}/ɣGE:nik.ݎĜր~|@=Oq X;qޜGd3KuuDqJ9z_ $F.bP竩ߘ斀]0[Nw>ROeAr4X sr{ֱ? ʾ c%ftLg߽!=@~ޫ^j0۞CFf(d91sYߵ)ir8?qק֫'ڝEdoNgE=9VRqD" 엓>Orq֜mYy譐Tdңoi# esƬ[3N @{t(eJd8~P͗/v9<%2BGFp9=|U}@8i}{{ ıBv\իr+Gs)Զev,r~ӥN:cҩܩO?ϟ \g'dq0HP}iq&CFbz==ꀮ/`k |@cOG>ܝ?S\=đ5@F[V~_O[o8CK2y#hdj(. i2,avA}ÁI>AKYovrFqӵE5Q|~YGNHbtn\~n~v2*a@$yvc2YVE<W眚nq`~?i+Kkpldex~i[u&L0ʟ?QTBv8u;kN\ý\#:ЮcbG.e0͓?&Bu=Cs\ZWSyJ܁ƳntZGu2~&[^pB: ?{Վ1M4fG4cC)=6 zpOr? 6=x5/krg $EF?/NyqEEF_edoky yhAA:|҃N:HR2+ihl#vJ~Y?J ^219u1u]Z_uTGx,r)[pzSg'~iz P Ar* KtI6>dӉXBOcC?_jۏ΢χ$v=S@ڸqvgjC6@;I|{V.k?~[EYMݍS} fhZaXZOYkLhTIEPEPEPAE3AT4A~ (.m켯ʱ9(z*gΐHWR qA`,ٛqE!qEiT#֬$Y_5`!b۝vwGxeyc *eGuu:0U~ӥ]E$ܟLEhS&'eJif&ghM l2eivǀ8rޏ;q@KOʎrhshȣQ;B3J^}(1K1@sҌ )⁆iqH1F*)&q4t{Ru4@8F=39#*`X`QRY\qk+3>:lYrk̄#&BDiVR8Ͽ?LLHc0jv_"X,#ЏΞeS$qYZw5M1'Ԝo[ŪX7˖wu=WOw}Q+|QFYr6"]!U˧vڤe7Ğ'oj2 `ɪn'\ m_/*`M{gڴ5!3h#ܙy6t JI&eLvsn#{DJGR{u: E Tt"¨'5Jrw"s +z >Z"z: 9ݴ쿗M[-9s;:R zdyڄ#s/4Bir#9qyXK[[L$ldN+zigDJ&aq-Jp;glme 2GҹG31a6182WЯ^e;uȒx`kmF^ҧcoV(f[(ePv/g%U8;OCX!&i`p{ ʴ,4m}J eAƥ:>K{4is@{gғ\] O=?d s;yJ>"h~/5L6ό$w84^]-,K*Ɣff m$P6$gYy<ZR_,$^V+. %hu4kg~G͠Ԡ}#ÕYxEv7,^a;!It=[%1h`.dP?ZhE!_6@e79EN3|z3e:^՚:!ZC=~᳂ Ojɾ -or}'|Vō4|W 3.ycPCuqFW8fIRR[8Gjv>Q@ӛhe#D COY3q˞QLm|dqOI1KWGwhk R2=8Yv3iqb=JQJ\Vv;%%tCJGBiz 4נ,׮c HK@ i?.{]mv(-Bg@rӵf^h7 mg:\χH "%v\7}kK[Q_Cbm{L-+gNj('.mH8q! `{~>ۯ^D'"t2k+۩td"QupsXVBpqz] ]!Ӽx ;+䱬6ny&1Ԭ$gUONZq8ٻgBQ[6-7!c'ۈ'j6QE¸ʜ*ā]YOCkI/Sг֩OF`;I-~h%d?YFI?+FA?xغ~μM ߌp&^}1A?)f#Vmf`u>ZvofnOLW*~f6+[0]w[WiJZ̻p+/'>??F/"Λ^Z(((ҊJNhWꆇ -?E_jYn!#IJl; ֺz0(NrjՄ\5`f"5l2Ȫ˃ \lm>ۆj g#vRjve r1lr*ZP&2՘+QEcIu[mc2C3 F(aM IVpDf s'qƴqF(QHdW0 &$b+5$eo&}2zר)lѬ"21Gi;ӟOyd{\~z.F?1֜A'1h]Rt1I~9L-'J:Kz Cǭg3IJy'֌ihG~8AIh ~tcPFsz44'ҁӶ(r0iqZi֟ nM⏭9e6 Ԅ#F' G?i* !1sRF~@ÃYIu7$3Y׈ιe'ZmI<Ö-ߚHWoA,~s\|?>-6e~TqϯZ>Bo L~"QTnCyYd_)#oוxڼwNZ8vo0(zױ~^Q7y֓=)LD9¨5Id2U K!M-g&ǩai%7W FW9z˵Z:+4Q\ (ϭ (`+:mfY G25 [\%g!v TQb5{RYM"-ᡵvIeP I.u[Yf-28K(9dJsj\[kVUbzn?:vzA90 91GZ\ړ =qIިizjNK'He]CO줵e">;Ev0 я]ps޼q+b;[. jMrҩRXb m 3V汱7fhP?HoσZFR@0=lOieII;IRkm5XuU!E O^O;~#Wdvȼ!%JWNegWnLmmeim%9$??c:rP 1<Fϱyu0 Ӓff?,qKf͞>n)\gsW1ө3JTݟd(;>t->dVSVsmJO=Ɨygx'o \+W[/' w\ R\A{Lu3y9c\ZG:G'GG?«oe\NzRޝ "B=@j+$8jE6R ڮ4{?SUW֏E/LSiZ? @sGvЬPD^fx[#b#VqՓΊQQQE<+"ƛ\J:rEPEPEPAҀ(h|'(*gh:s@Q@Q@Q@fE4QFhQ2(bIdՆ 5dymhh$TȪWyCqۿ>.N7ZY{G(1JGO\;SƿNq}NEFfw2/h7z ,"ONw~o='-[ ۭ'njh>#)Q7p O UNd?Uiլ YW֋Kީk [o9Ƭ* "utnC)qEހ(jZk( V*p,N楂9I"pȻH 2Oev0)'/toIdYZʆק5@loPB7ޛ 渭J]֎)o%݈&r'ޮ|-n|Ϊp3_Qjƣomj*A,5[ڍ%2D=҂;ҙz?WHHf+9U?ҖzpGQ-)"PE>Z*9?Sި$?Q϶}kJ.rVݘvV}i E TTZbMo! )cNwXмe8)Y`y$.'*Hד $@0aoAiR_J^-\ooAW[fVi vc*EzOY~˳|3zⱮuXuhK,Ng T.{u%هsl[$,dq0}vڋ?MﱧSK:mbsҘmb'av_aUtMQ,[ 9פ<_jijPySAGSʟQZnN8*׻ys !/2I8d2sX}maqv>X'~fG&8QN L+ԅHWG Z2+36D 0:`ұqS1(1xr?MqzdUV 0LL ?яsS㵆&ޱ07ߙxt~}J[r$bp< bIh0G H%ŵ$kqcMC[,nӖhܱG^MW] ՛I r!,6:qv)"Ȫr22H=}j5519K}#QXHhjU 9U[o֭cLd3ݳvsj=l>u\I##ryG֥'UCzkʅ\V ߯֓Gib{fjӼ.?nCҥ;Pe]~8ßO#?_Cqi +H2QհjV4R&cJG>L-"/&Ax8Uu#Vrӹ2=s˸rp}Vϵ72ScZM2ܪmq'_aY#,g sϠW&kpwc2 =@llkxN=*Թ58jBV~N~܌c?ybhUtf껮*_io$-ԏQz%>tmf =uiSyqKnsB++Kw_B't/k_3q*I+Z՗8F~Y-b#܁"\ݕQE%Y>݈=++#GiERQEQF(Ҋ(7sҬiPEQ@<ugk:zfP!*N 5T5rPfzt"e2ImcùZ#QjFy˂~e?%-ڞ^keapy_OqRwa$_ח_[LI$q4wO#pFAU}.认M Yr+SKmq%AǠj)s 89{)I9~ N{5yboւ9?zj G.O4';|O9jOX͔eQ 0#egtBD9FHa?XGe:djGfГ=5j1$l 6p3׏b:7c>@T zӵWfw ~xd|GkF9E5o8 y9hF`&gL=@>#2sFp;W1b$ZJD S2F@ %z5,hmLO>\`=2sX V\~Njj6he8 x]hAѨQHaEPEPAE04=K O]6rE~cڬinzYd~0rwS|Ēo4;[HY]OYˊ7]TX$Gcwq+z5S.ުiBD3}iyG_69*P?_(ʐHQFI=mN?9@-rV574L=q?YNs]4g-j>TYTFk 1إIY#` -_'EZi.d*YEW1a^hM=Eymmp7Ox_ pvF$<|?.wgdmvqƖ][+J Lc Uh"8tna<8\xV+$ Bc\d\Ð=4,Y8̀}ځeiQLѬaUBmrs4 FhxSZy\ qw&DFB'uMrSDOЉ+RY|$ c. HX~y=0dz``@ԖQq{b̯EWuAZ(Y9Z|F GNr*ޜVΖ0 ȭX099jC7K7.0Ҙ1ZSf6AyTf}CwkZlI" y2x|B.}R[~  3ӌҧ,ȩLY{w,sO@ԭ'R4Q8bx tZwRG $K2u豽̷0A< G`\`EOeGaQ$6Cn,}5.QEd1=ڷMaXɟ/j5v'9q $[C p:qW֌~UgvԸ&;O!'Qi;R4$gpJ>Q"Q ].7Fi; 09+`J5a9~}uWrU9e8im 릷EXi8PzR}B%DAԮ^  y<RU N8 un d($IΗW0A<ю9w&2BO Ga7d8;]Bҹ}O9=+[eh%qI״vsR. 4 i@ rN4SI4&x dBcI\)$ԜsP7kvU6F1ڔ[Hl ~wgfcIt/?(Jmv7~]#=Sݿ43ǯjYc>J^}|uc0:К8I턏° ?1p}k m{|FvKo FߙA$gTQ+G='f,eHv<4fu6r9xe~XĈ$j@8TvژY&1juBKt2qq|/O?hOST1$5tuJe=* 9qnUNJH:g҃j]n.mr;:\:0_XjQrT;qORî}ٚJ*K??L)z`F=F{Vd&8)ēF*FR J#'z@E2K9I{~BO)ޮ}9pTA*[|?bs?*^nm[k30 O\s{‡V}=ArXN:4OdTq\GicGMtBhMSJ$l2#ڨ[K8 Z5Z!er?Bwхdib<ӤK&.Lt}kF(U%㫐?KE `zOկY> mG@5C ( ( J(=(7@F#ZU"CjҡQEU c%?jLjŠ QE`jdY@?6qW5x߬.3wRV6Ս1C5[9zսKl8>:* t~4tQEp|fVƑ26}Ԋ_]K3w|F'hL A1S ?ŷMJ u1Vr8Ќѫ]-Fk1P5췚5@!p}";RU 30#o-+My(QF QdӮhE} Wc-L`x)NX|p?^w_o.l,K6շ|8qcrI;^{{trKHzQ&jeO]Gb"n#n*.H}5f8Q 8gl${t.Fǯj[;[Ҿ|i+DxU$r?)h8 fIdfܲlnu+SGhWOYY7o.1N,jNH棓I#I-"d* : z{Qt-U-"UF ZC (XvYƭXVg˟F5iwu4hv3^hhRrkȢ7?9O$VdPpAұ9>`=9fej#8~?SUsWmʖsxG;ZSAe%@{{CX!L=UU# jZ\ͲnaiJWVflyS$LŚ'*I3i︺~d~/QOt-XsTnst ڪ7ݢVy|r}6if*ӿa#u՗&c9#Ґt]3!ך2i =h`/=ajn*l1Oz23I> ܒk#[\aWU1ri";I8`fǻ#޴: U#VA'\S\d.G@<]^g#uD:}Ƥ7U4+v$. I~/e#e xer> $i_޺֑zUR0(^p-&ȣ;z Y%PGbb8j)w$ dnrU\בFv|'|PpA?ZdrG2oeEI^~5Vݥ$t9V}A5o3RrH&ѕ8+Ks68e=Tԣ}j P%E?Ƭuَioq.y99L8yi{>Fb@{Qz~<:3QΦFy'd \ҿ{qq:;cNHլ}k[A i|aTdiV껅;Pe z?Х$/fFv_ʽ{MG\M4!$mP2Tzb"uO1KFH$q…NvM-Þ)or2AvQ< ixMKR ^Þ=J~Oz Ͼ"H 3*tF5KMhʽz(Š((( IDjӬ!?묿1NEPTu}jREPNͮ>GC0pA5U[6IzH[Sɣ0KTs@$U$Vhm-p{`~}6:3}3ҭQR6)RQEbns_*}P